Incidental Mutation 'R4276:Acad8'
ID322704
Institutional Source Beutler Lab
Gene Symbol Acad8
Ensembl Gene ENSMUSG00000031969
Gene Nameacyl-Coenzyme A dehydrogenase family, member 8
Synonyms
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26974135-26999566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26978449 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 316 (Q316H)
Ref Sequence ENSEMBL: ENSMUSP00000112908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060513] [ENSMUST00000120367] [ENSMUST00000128923] [ENSMUST00000132293]
Predicted Effect probably null
Transcript: ENSMUST00000060513
AA Change: Q316H

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054370
Gene: ENSMUSG00000031969
AA Change: Q316H

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 1e-28 PFAM
Pfam:Acyl-CoA_dh_M 155 207 1.8e-23 PFAM
Pfam:Acyl-CoA_dh_1 261 411 2.9e-47 PFAM
Pfam:Acyl-CoA_dh_2 276 399 1.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120367
AA Change: Q316H

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112908
Gene: ENSMUSG00000031969
AA Change: Q316H

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 7.8e-29 PFAM
Pfam:Acyl-CoA_dh_M 155 249 3.7e-28 PFAM
Pfam:Acyl-CoA_dh_1 261 411 5.7e-45 PFAM
Pfam:Acyl-CoA_dh_2 276 400 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129490
Predicted Effect probably benign
Transcript: ENSMUST00000132293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151075
Predicted Effect probably benign
Transcript: ENSMUST00000215693
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cold intolerance at young age with a progressive hepatic steatosis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Acad8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Acad8 APN 9 26990594 missense probably damaging 1.00
IGL01721:Acad8 APN 9 26992267 splice site probably benign
R1473:Acad8 UTSW 9 26979041 missense probably benign 0.00
R2102:Acad8 UTSW 9 26985565 nonsense probably null
R3030:Acad8 UTSW 9 26979059 missense probably benign 0.04
R4023:Acad8 UTSW 9 26979185 missense probably benign 0.02
R4667:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4668:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4669:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4898:Acad8 UTSW 9 26978402 missense probably damaging 1.00
R5418:Acad8 UTSW 9 26985557 missense probably damaging 1.00
R5486:Acad8 UTSW 9 26999495 start codon destroyed probably null
R5549:Acad8 UTSW 9 26985551 missense probably damaging 1.00
R5887:Acad8 UTSW 9 26979324 splice site probably null
R5943:Acad8 UTSW 9 26999444 missense probably benign 0.00
R7150:Acad8 UTSW 9 26978454 missense probably damaging 1.00
R7197:Acad8 UTSW 9 26977671 splice site probably null
R7226:Acad8 UTSW 9 26978430 nonsense probably null
R7561:Acad8 UTSW 9 26979242 missense probably benign 0.03
R7812:Acad8 UTSW 9 26979180 missense probably damaging 1.00
R8360:Acad8 UTSW 9 26979056 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTCTCAGGAAGGCCAGAAG -3'
(R):5'- GCAGTAATACCAAGGCAAGC -3'

Sequencing Primer
(F):5'- TCTCAGGAAGGCCAGAAGACTTATC -3'
(R):5'- CATGTCACAGTGCCTATGTAGAG -3'
Posted On2015-06-20