Incidental Mutation 'R4276:Ern1'
ID322706
Institutional Source Beutler Lab
Gene Symbol Ern1
Ensembl Gene ENSMUSG00000020715
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 1
SynonymsIre1a, Ire1alpha, 9030414B18Rik, Ire1p
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106394650-106487852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106407181 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 705 (I705V)
Ref Sequence ENSEMBL: ENSMUSP00000001059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001059]
PDB Structure
Crystal structure of murine IRE1 in complex with MKC9989 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR464 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR573 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001059
AA Change: I705V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001059
Gene: ENSMUSG00000020715
AA Change: I705V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
low complexity region 471 501 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Pfam:Pkinase 571 832 1.8e-44 PFAM
Pfam:Pkinase_Tyr 572 829 8.7e-26 PFAM
PUG 895 952 5.25e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131895
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations display embryonic lethality during organogenesis. Homozygous mice may also display decreased embryo size, impaired hematopoiesis, and/or placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Ern1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ern1 APN 11 106421967 missense probably benign 0.02
IGL01938:Ern1 APN 11 106411657 missense probably benign
IGL02813:Ern1 APN 11 106423425 missense probably damaging 1.00
IGL02928:Ern1 APN 11 106405879 splice site probably benign
IGL02931:Ern1 APN 11 106423440 missense probably damaging 1.00
IGL03153:Ern1 APN 11 106410098 missense possibly damaging 0.63
Immoderate UTSW 11 106420042 missense possibly damaging 0.93
Militant UTSW 11 106411652 missense probably damaging 1.00
K7371:Ern1 UTSW 11 106400275 missense probably damaging 1.00
R0090:Ern1 UTSW 11 106405823 missense probably damaging 1.00
R0391:Ern1 UTSW 11 106407178 nonsense probably null
R0411:Ern1 UTSW 11 106398586 missense probably benign
R0627:Ern1 UTSW 11 106398693 missense probably benign 0.00
R1416:Ern1 UTSW 11 106421980 splice site probably benign
R1831:Ern1 UTSW 11 106399842 splice site probably null
R1837:Ern1 UTSW 11 106458957 missense probably damaging 1.00
R1944:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1945:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1954:Ern1 UTSW 11 106421974 splice site probably benign
R1957:Ern1 UTSW 11 106426897 missense probably damaging 1.00
R2192:Ern1 UTSW 11 106409924 missense probably benign
R4277:Ern1 UTSW 11 106407181 missense probably benign
R4471:Ern1 UTSW 11 106420042 missense possibly damaging 0.93
R4583:Ern1 UTSW 11 106407205 missense probably damaging 1.00
R4731:Ern1 UTSW 11 106434850 intron probably benign
R5177:Ern1 UTSW 11 106411775 missense probably benign 0.01
R5489:Ern1 UTSW 11 106407529 missense probably damaging 1.00
R5538:Ern1 UTSW 11 106421901 missense possibly damaging 0.83
R5806:Ern1 UTSW 11 106398705 missense probably damaging 0.96
R5922:Ern1 UTSW 11 106421730 missense probably damaging 0.97
R5931:Ern1 UTSW 11 106426873 missense possibly damaging 0.86
R5990:Ern1 UTSW 11 106411769 missense probably benign
R6149:Ern1 UTSW 11 106405815 nonsense probably null
R6253:Ern1 UTSW 11 106426908 missense possibly damaging 0.89
R6721:Ern1 UTSW 11 106411652 missense probably damaging 1.00
R6957:Ern1 UTSW 11 106403539 missense probably damaging 1.00
R7362:Ern1 UTSW 11 106437123 missense probably damaging 1.00
R7387:Ern1 UTSW 11 106421952 missense probably damaging 0.98
R7494:Ern1 UTSW 11 106407535 missense probably damaging 1.00
R7514:Ern1 UTSW 11 106409893 critical splice donor site probably null
R7767:Ern1 UTSW 11 106400308 missense probably damaging 1.00
R7811:Ern1 UTSW 11 106434868 missense unknown
R7869:Ern1 UTSW 11 106459019 nonsense probably null
X0021:Ern1 UTSW 11 106398606 missense probably damaging 1.00
X0022:Ern1 UTSW 11 106458919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACACTGTTCACACCTGTC -3'
(R):5'- ACATTTTGAAGATGACAGCAGG -3'

Sequencing Primer
(F):5'- CCTGTCTGTCTTAGAACATGAAACG -3'
(R):5'- GTATTTAGGAAGCTGACAAAGATCC -3'
Posted On2015-06-20