Mutagenetix > Incidental Mutations

Incidental Mutation 'R4276:Ern1'

322706

Institutional Source

Beutler Lab

Gene Symbol

Ern1

Ensembl Gene

ENSMUSG00000020715

Gene Name

endoplasmic reticulum (ER) to nucleus signalling 1

Synonyms

Ire1a, Ire1alpha, 9030414B18Rik, Ire1p

MMRRC Submission

041647-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106394650-106487852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106407181 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 705 (I705V)

Ref Sequence

ENSEMBL: ENSMUSP00000001059 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001059]

PDB Structure

Crystal structure of murine IRE1 in complex with MKC9989 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR464 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR573 inhibitor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000001059
AA Change: I705V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000001059
Gene: ENSMUSG00000020715
AA Change: I705V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PQQ	28	59	3.46e-5	SMART
PQQ	110	142	1.11e-3	SMART
PQQ	148	180	7.84e-4	SMART
PQQ	191	223	3.26e-1	SMART
PQQ	279	310	5.01e1	SMART
low complexity region	471	501	N/A	INTRINSIC
low complexity region	513	551	N/A	INTRINSIC
Pfam:Pkinase	571	832	1.8e-44	PFAM
Pfam:Pkinase_Tyr	572	829	8.7e-26	PFAM
PUG	895	952	5.25e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131895

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations display embryonic lethality during organogenesis. Homozygous mice may also display decreased embryo size, impaired hematopoiesis, and/or placental abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad8	C	A	9: 26,978,449	Q316H	probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Brix1	T	C	15: 10,481,747	D101G	possibly damaging	Het
Cfap36	A	G	11: 29,230,584		probably null	Het
Chrnb3	A	G	8: 27,393,751	N172S	probably damaging	Het
Csnk1e	T	C	15: 79,429,767	N37S	probably damaging	Het
Gimap8	T	C	6: 48,659,083	M594T	probably benign	Het
Gm6578	G	A	6: 12,100,188		noncoding transcript	Het
Gpc6	A	G	14: 117,435,916	D195G	probably damaging	Het
Gpcpd1	T	C	2: 132,540,287	K412E	probably damaging	Het
Insm1	C	A	2: 146,222,968	H235N	probably benign	Het
Jmjd8	A	G	17: 25,829,813		probably benign	Het
Kbtbd8	T	C	6: 95,126,933	V521A	probably damaging	Het
Kcna5	T	C	6: 126,533,366	T600A	probably damaging	Het
Kctd6	G	C	14: 8,222,806	R216P	probably damaging	Het
Lbx1	C	A	19: 45,235,089	V47L	probably benign	Het
Mefv	A	T	16: 3,715,569	N279K	probably benign	Het
Mroh1	T	G	15: 76,393,851	V24G	probably damaging	Het
Nt5c1b	A	G	12: 10,374,886	E142G	probably damaging	Het
Olfr1038-ps	G	A	2: 86,122,279	A119T	probably damaging	Het
Olfr1289	G	T	2: 111,483,504	V25L	probably damaging	Het
Padi2	A	G	4: 140,936,548	E404G	possibly damaging	Het
Pitpnb	A	G	5: 111,371,392		probably null	Het
Plxna4	T	C	6: 32,200,948	N1006S	probably benign	Het
Proc	A	G	18: 32,135,914	V6A	probably benign	Het
Prrc2c	T	A	1: 162,673,591	K1214N	probably damaging	Het
Pstpip2	A	G	18: 77,861,856	I122V	probably benign	Het
Pus10	A	G	11: 23,706,895	E207G	probably damaging	Het
Rabl2	G	A	15: 89,584,188		probably benign	Het
Rbp3	G	A	14: 33,958,650	V1070I	probably benign	Het
Rtl6	T	A	15: 84,557,196		probably benign	Het
Scn7a	T	G	2: 66,684,063	K1122N	probably damaging	Het
Spag16	A	G	1: 69,873,481		probably benign	Het
Spata13	C	T	14: 60,756,296	R396C	probably damaging	Het
Stmn4	A	T	14: 66,355,717		probably benign	Het
Syp	G	T	X: 7,638,692		probably benign	Het
Tmem260	C	T	14: 48,477,636	T249M	probably damaging	Het
Tnrc6b	A	G	15: 80,901,971	I1239V	probably benign	Het
Ubr3	C	T	2: 69,938,387	Q510*	probably null	Het
Vegfa	A	G	17: 46,031,466	V142A	probably benign	Het
Vmn2r93	T	C	17: 18,304,830	I250T	possibly damaging	Het

Other mutations in Ern1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Ern1	APN	11	106421967	missense	probably benign	0.02
IGL01938:Ern1	APN	11	106411657	missense	probably benign
IGL02813:Ern1	APN	11	106423425	missense	probably damaging	1.00
IGL02928:Ern1	APN	11	106405879	splice site	probably benign
IGL02931:Ern1	APN	11	106423440	missense	probably damaging	1.00
IGL03153:Ern1	APN	11	106410098	missense	possibly damaging	0.63
Immoderate	UTSW	11	106420042	missense	possibly damaging	0.93
Militant	UTSW	11	106411652	missense	probably damaging	1.00
K7371:Ern1	UTSW	11	106400275	missense	probably damaging	1.00
R0090:Ern1	UTSW	11	106405823	missense	probably damaging	1.00
R0391:Ern1	UTSW	11	106407178	nonsense	probably null
R0411:Ern1	UTSW	11	106398586	missense	probably benign
R0627:Ern1	UTSW	11	106398693	missense	probably benign	0.00
R1416:Ern1	UTSW	11	106421980	splice site	probably benign
R1831:Ern1	UTSW	11	106399842	splice site	probably null
R1837:Ern1	UTSW	11	106458957	missense	probably damaging	1.00
R1944:Ern1	UTSW	11	106421950	missense	probably damaging	1.00
R1945:Ern1	UTSW	11	106421950	missense	probably damaging	1.00
R1954:Ern1	UTSW	11	106421974	splice site	probably benign
R1957:Ern1	UTSW	11	106426897	missense	probably damaging	1.00
R2192:Ern1	UTSW	11	106409924	missense	probably benign
R4277:Ern1	UTSW	11	106407181	missense	probably benign
R4471:Ern1	UTSW	11	106420042	missense	possibly damaging	0.93
R4583:Ern1	UTSW	11	106407205	missense	probably damaging	1.00
R4731:Ern1	UTSW	11	106434850	intron	probably benign
R5177:Ern1	UTSW	11	106411775	missense	probably benign	0.01
R5489:Ern1	UTSW	11	106407529	missense	probably damaging	1.00
R5538:Ern1	UTSW	11	106421901	missense	possibly damaging	0.83
R5806:Ern1	UTSW	11	106398705	missense	probably damaging	0.96
R5922:Ern1	UTSW	11	106421730	missense	probably damaging	0.97
R5931:Ern1	UTSW	11	106426873	missense	possibly damaging	0.86
R5990:Ern1	UTSW	11	106411769	missense	probably benign
R6149:Ern1	UTSW	11	106405815	nonsense	probably null
R6253:Ern1	UTSW	11	106426908	missense	possibly damaging	0.89
R6721:Ern1	UTSW	11	106411652	missense	probably damaging	1.00
R6957:Ern1	UTSW	11	106403539	missense	probably damaging	1.00
R7362:Ern1	UTSW	11	106437123	missense	probably damaging	1.00
R7387:Ern1	UTSW	11	106421952	missense	probably damaging	0.98
R7494:Ern1	UTSW	11	106407535	missense	probably damaging	1.00
R7514:Ern1	UTSW	11	106409893	critical splice donor site	probably null
R7767:Ern1	UTSW	11	106400308	missense	probably damaging	1.00
R7811:Ern1	UTSW	11	106434868	missense	unknown
R7869:Ern1	UTSW	11	106459019	nonsense	probably null
X0021:Ern1	UTSW	11	106398606	missense	probably damaging	1.00
X0022:Ern1	UTSW	11	106458919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGACACTGTTCACACCTGTC -3'
(R):5'- ACATTTTGAAGATGACAGCAGG -3'

Sequencing Primer
(F):5'- CCTGTCTGTCTTAGAACATGAAACG -3'
(R):5'- GTATTTAGGAAGCTGACAAAGATCC -3'

Posted On

2015-06-20