Incidental Mutation 'R4276:Brix1'
ID322714
Institutional Source Beutler Lab
Gene Symbol Brix1
Ensembl Gene ENSMUSG00000022247
Gene NameBRX1, biogenesis of ribosomes
Synonyms1110064N10Rik, Bxdc2
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R4276 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10474779-10485947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10481747 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 101 (D101G)
Ref Sequence ENSEMBL: ENSMUSP00000127437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000168761] [ENSMUST00000169050] [ENSMUST00000169519] [ENSMUST00000170100]
Predicted Effect probably benign
Transcript: ENSMUST00000022855
AA Change: D95G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247
AA Change: D95G

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022856
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100775
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168408
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000169050
AA Change: D101G

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247
AA Change: D101G

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169519
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170100
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Brix1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03136:Brix1 APN 15 10478766 missense probably damaging 0.97
R1266:Brix1 UTSW 15 10478761 missense probably damaging 1.00
R4320:Brix1 UTSW 15 10483312 missense probably damaging 1.00
R4824:Brix1 UTSW 15 10485742 missense possibly damaging 0.90
R4902:Brix1 UTSW 15 10483292 splice site probably null
R6018:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6019:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6021:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6022:Brix1 UTSW 15 10476589 missense probably benign 0.26
R7203:Brix1 UTSW 15 10483292 splice site probably null
R7218:Brix1 UTSW 15 10483292 splice site probably null
R7522:Brix1 UTSW 15 10476590 missense probably damaging 1.00
R8390:Brix1 UTSW 15 10485868 missense probably benign
X0023:Brix1 UTSW 15 10478686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGATAATCCTTGAGTACCTTCTG -3'
(R):5'- TAAAGAGGGCTTAGCTGCAG -3'

Sequencing Primer
(F):5'- CTTGAGTACCTTCTGTAAGTTTCAAG -3'
(R):5'- CCGTACAGTGGCAAGTGTG -3'
Posted On2015-06-20