Mutagenetix > Incidental Mutation

Incidental Mutation 'R4276:Csnk1e'

322716

Institutional Source

Beutler Lab

Gene Symbol

Csnk1e

Ensembl Gene

ENSMUSG00000022433

Gene Name

casein kinase 1, epsilon

Synonyms

tau, CKIepsilon, CK1epsilon, CKI epsilon, KC1epsilon

MMRRC Submission

041647-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79302056-79339767 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79313967 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 37 (N37S)

Ref Sequence

ENSEMBL: ENSMUSP00000155186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117786] [ENSMUST00000120859] [ENSMUST00000122044] [ENSMUST00000135519] [ENSMUST00000144790] [ENSMUST00000229510] [ENSMUST00000230599] [ENSMUST00000230942] [ENSMUST00000156043]

AlphaFold

Q9JMK2

Predicted Effect

probably damaging
Transcript: ENSMUST00000117786
AA Change: N94S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113341
Gene: ENSMUSG00000022433
AA Change: N94S

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	273	8.7e-18	PFAM
Pfam:Pkinase	9	277	5.2e-28	PFAM
low complexity region	306	316	N/A	INTRINSIC
low complexity region	329	338	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120859
AA Change: N94S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113975
Gene: ENSMUSG00000022433
AA Change: N94S

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	273	9.8e-18	PFAM
Pfam:Pkinase	9	280	7e-40	PFAM
low complexity region	306	316	N/A	INTRINSIC
low complexity region	329	338	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122044
AA Change: N94S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113096
Gene: ENSMUSG00000022433
AA Change: N94S

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	273	7.9e-18	PFAM
Pfam:Pkinase	9	280	5.7e-40	PFAM
low complexity region	309	324	N/A	INTRINSIC
low complexity region	345	350	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000135519
AA Change: N94S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000122135
Gene: ENSMUSG00000022433
AA Change: N94S

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	118	1.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137028

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144790
AA Change: N94S

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000115637
Gene: ENSMUSG00000022433
AA Change: N94S

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	141	9.3e-24	PFAM
Pfam:Pkinase_Tyr	9	141	5.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156513

Predicted Effect

probably damaging
Transcript: ENSMUST00000229510
AA Change: N37S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000230599
AA Change: N94S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000230942
AA Change: N94S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000156043

SMART Domains

Protein: ENSMUSP00000116593
Gene: ENSMUSG00000022433

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	60	1.4e-6	PFAM

Meta Mutation Damage Score

0.2200

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit disruptions in circadian rhythms. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad8	C	A	9: 26,889,745 (GRCm39)	Q316H	probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 117,721,122 (GRCm39)		probably benign	Het
Brix1	T	C	15: 10,481,833 (GRCm39)	D101G	possibly damaging	Het
Cfap36	A	G	11: 29,180,584 (GRCm39)		probably null	Het
Chrnb3	A	G	8: 27,883,779 (GRCm39)	N172S	probably damaging	Het
Ern1	T	C	11: 106,298,007 (GRCm39)	I705V	probably benign	Het
Gimap8	T	C	6: 48,636,017 (GRCm39)	M594T	probably benign	Het
Gm6578	G	A	6: 12,100,187 (GRCm39)		noncoding transcript	Het
Gpc6	A	G	14: 117,673,328 (GRCm39)	D195G	probably damaging	Het
Gpcpd1	T	C	2: 132,382,207 (GRCm39)	K412E	probably damaging	Het
Insm1	C	A	2: 146,064,888 (GRCm39)	H235N	probably benign	Het
Jmjd8	A	G	17: 26,048,787 (GRCm39)		probably benign	Het
Kbtbd8	T	C	6: 95,103,914 (GRCm39)	V521A	probably damaging	Het
Kcna5	T	C	6: 126,510,329 (GRCm39)	T600A	probably damaging	Het
Kctd6	G	C	14: 8,222,806 (GRCm38)	R216P	probably damaging	Het
Lbx1	C	A	19: 45,223,528 (GRCm39)	V47L	probably benign	Het
Mefv	A	T	16: 3,533,433 (GRCm39)	N279K	probably benign	Het
Mroh1	T	G	15: 76,278,051 (GRCm39)	V24G	probably damaging	Het
Nt5c1b	A	G	12: 10,424,886 (GRCm39)	E142G	probably damaging	Het
Or4f4b	G	T	2: 111,313,849 (GRCm39)	V25L	probably damaging	Het
Or8u3-ps	G	A	2: 85,952,623 (GRCm39)	A119T	probably damaging	Het
Padi2	A	G	4: 140,663,859 (GRCm39)	E404G	possibly damaging	Het
Pitpnb	A	G	5: 111,519,258 (GRCm39)		probably null	Het
Plxna4	T	C	6: 32,177,883 (GRCm39)	N1006S	probably benign	Het
Proc	A	G	18: 32,268,967 (GRCm39)	V6A	probably benign	Het
Prrc2c	T	A	1: 162,501,160 (GRCm39)	K1214N	probably damaging	Het
Pstpip2	A	G	18: 77,949,556 (GRCm39)	I122V	probably benign	Het
Pus10	A	G	11: 23,656,895 (GRCm39)	E207G	probably damaging	Het
Rabl2	G	A	15: 89,468,391 (GRCm39)		probably benign	Het
Rbp3	G	A	14: 33,680,607 (GRCm39)	V1070I	probably benign	Het
Rtl6	T	A	15: 84,441,397 (GRCm39)		probably benign	Het
Scn7a	T	G	2: 66,514,407 (GRCm39)	K1122N	probably damaging	Het
Spag16	A	G	1: 69,912,640 (GRCm39)		probably benign	Het
Spata13	C	T	14: 60,993,745 (GRCm39)	R396C	probably damaging	Het
Stmn4	A	T	14: 66,593,166 (GRCm39)		probably benign	Het
Syp	G	T	X: 7,504,931 (GRCm39)		probably benign	Het
Tmem260	C	T	14: 48,715,093 (GRCm39)	T249M	probably damaging	Het
Tnrc6b	A	G	15: 80,786,172 (GRCm39)	I1239V	probably benign	Het
Ubr3	C	T	2: 69,768,731 (GRCm39)	Q510*	probably null	Het
Vegfa	A	G	17: 46,342,392 (GRCm39)	V142A	probably benign	Het
Vmn2r93	T	C	17: 18,525,092 (GRCm39)	I250T	possibly damaging	Het

Other mutations in Csnk1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0624:Csnk1e	UTSW	15	79,304,098 (GRCm39)	unclassified	probably benign
R1281:Csnk1e	UTSW	15	79,304,841 (GRCm39)	missense	possibly damaging	0.80
R1618:Csnk1e	UTSW	15	79,309,050 (GRCm39)	missense	probably benign	0.02
R3005:Csnk1e	UTSW	15	79,323,005 (GRCm39)	missense	probably benign	0.42
R4241:Csnk1e	UTSW	15	79,309,095 (GRCm39)	missense	probably damaging	1.00
R4242:Csnk1e	UTSW	15	79,309,095 (GRCm39)	missense	probably damaging	1.00
R4438:Csnk1e	UTSW	15	79,305,129 (GRCm39)	missense	probably benign	0.08
R4994:Csnk1e	UTSW	15	79,309,129 (GRCm39)	missense	probably damaging	1.00
R5071:Csnk1e	UTSW	15	79,305,072 (GRCm39)	nonsense	probably null
R7072:Csnk1e	UTSW	15	79,322,967 (GRCm39)	splice site	probably null
R7553:Csnk1e	UTSW	15	79,310,566 (GRCm39)	missense	probably damaging	1.00
R8379:Csnk1e	UTSW	15	79,304,882 (GRCm39)	missense	possibly damaging	0.88
R8721:Csnk1e	UTSW	15	79,314,015 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GACTCAGGGTTGGTATGCAG -3'
(R):5'- CTACAAGATGATGCAGGGCG -3'

Sequencing Primer
(F):5'- TTGGTATGCAGGGCCCAG -3'
(R):5'- GGCTGAGGGAGACTATAAC -3'

Posted On

2015-06-20