Mutagenetix > Incidental Mutations

Incidental Mutation 'R4276:Tnrc6b'

322717

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

041647-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R4276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80901971 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1239 (I1239V)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

Predicted Effect

probably benign
Transcript: ENSMUST00000067689
AA Change: I1239V

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: I1239V

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

unknown
Transcript: ENSMUST00000228124
AA Change: I386V

Meta Mutation Damage Score

0.0578

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (46/47)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad8	C	A	9: 26,978,449	Q316H	probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Brix1	T	C	15: 10,481,747	D101G	possibly damaging	Het
Cfap36	A	G	11: 29,230,584		probably null	Het
Chrnb3	A	G	8: 27,393,751	N172S	probably damaging	Het
Csnk1e	T	C	15: 79,429,767	N37S	probably damaging	Het
Ern1	T	C	11: 106,407,181	I705V	probably benign	Het
Gimap8	T	C	6: 48,659,083	M594T	probably benign	Het
Gm6578	G	A	6: 12,100,188		noncoding transcript	Het
Gpc6	A	G	14: 117,435,916	D195G	probably damaging	Het
Gpcpd1	T	C	2: 132,540,287	K412E	probably damaging	Het
Insm1	C	A	2: 146,222,968	H235N	probably benign	Het
Jmjd8	A	G	17: 25,829,813		probably benign	Het
Kbtbd8	T	C	6: 95,126,933	V521A	probably damaging	Het
Kcna5	T	C	6: 126,533,366	T600A	probably damaging	Het
Kctd6	G	C	14: 8,222,806	R216P	probably damaging	Het
Lbx1	C	A	19: 45,235,089	V47L	probably benign	Het
Mefv	A	T	16: 3,715,569	N279K	probably benign	Het
Mroh1	T	G	15: 76,393,851	V24G	probably damaging	Het
Nt5c1b	A	G	12: 10,374,886	E142G	probably damaging	Het
Olfr1038-ps	G	A	2: 86,122,279	A119T	probably damaging	Het
Olfr1289	G	T	2: 111,483,504	V25L	probably damaging	Het
Padi2	A	G	4: 140,936,548	E404G	possibly damaging	Het
Pitpnb	A	G	5: 111,371,392		probably null	Het
Plxna4	T	C	6: 32,200,948	N1006S	probably benign	Het
Proc	A	G	18: 32,135,914	V6A	probably benign	Het
Prrc2c	T	A	1: 162,673,591	K1214N	probably damaging	Het
Pstpip2	A	G	18: 77,861,856	I122V	probably benign	Het
Pus10	A	G	11: 23,706,895	E207G	probably damaging	Het
Rabl2	G	A	15: 89,584,188		probably benign	Het
Rbp3	G	A	14: 33,958,650	V1070I	probably benign	Het
Rtl6	T	A	15: 84,557,196		probably benign	Het
Scn7a	T	G	2: 66,684,063	K1122N	probably damaging	Het
Spag16	A	G	1: 69,873,481		probably benign	Het
Spata13	C	T	14: 60,756,296	R396C	probably damaging	Het
Stmn4	A	T	14: 66,355,717		probably benign	Het
Syp	G	T	X: 7,638,692		probably benign	Het
Tmem260	C	T	14: 48,477,636	T249M	probably damaging	Het
Ubr3	C	T	2: 69,938,387	Q510*	probably null	Het
Vegfa	A	G	17: 46,031,466	V142A	probably benign	Het
Vmn2r93	T	C	17: 18,304,830	I250T	possibly damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TTCAAGAAAATGGCAGTCCTTG -3'
(R):5'- AGAGCTAAGGTTACCTTCAGGC -3'

Sequencing Primer
(F):5'- AATGGCAGTCCTTGATTTAGAGCC -3'
(R):5'- GCTAAGGTTACCTTCAGGCAAACTG -3'

Posted On

2015-06-20