Incidental Mutation 'R4276:Rabl2'
ID322719
Institutional Source Beutler Lab
Gene Symbol Rabl2
Ensembl Gene ENSMUSG00000022621
Gene NameRAB, member RAS oncogene family-like 2
Synonyms1110031N17Rik, Rabl2a
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89582533-89591923 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 89584188 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023294] [ENSMUST00000094056] [ENSMUST00000169466] [ENSMUST00000170126] [ENSMUST00000171580] [ENSMUST00000172053]
Predicted Effect probably benign
Transcript: ENSMUST00000023294
SMART Domains Protein: ENSMUSP00000023294
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Pfam:Arf 10 196 2.3e-12 PFAM
Pfam:MMR_HSR1 23 134 1.4e-6 PFAM
Pfam:Roc 23 137 2e-35 PFAM
Pfam:Gtr1_RagA 23 171 9e-8 PFAM
Pfam:Ras 23 180 3.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094056
SMART Domains Protein: ENSMUSP00000091598
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Blast:RAB 50 94 4e-10 BLAST
SCOP:d3raba_ 57 91 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165747
Predicted Effect probably benign
Transcript: ENSMUST00000169466
SMART Domains Protein: ENSMUSP00000129660
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 53 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170126
SMART Domains Protein: ENSMUSP00000126182
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Pfam:Ras 23 74 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171142
Predicted Effect probably benign
Transcript: ENSMUST00000171580
SMART Domains Protein: ENSMUSP00000128799
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 38 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171826
SMART Domains Protein: ENSMUSP00000129221
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Blast:RAB 2 49 7e-16 BLAST
SCOP:d1fzqa_ 3 49 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172053
SMART Domains Protein: ENSMUSP00000129253
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Pfam:Arf 10 100 6.5e-9 PFAM
Pfam:Miro 23 102 1.7e-11 PFAM
Pfam:Ras 23 102 4.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172074
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility, reduced testis weight, oligospermia, asthenozoospermia and short flagellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Rabl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Rabl2 APN 15 89590270 splice site probably benign
IGL01612:Rabl2 APN 15 89583412 missense probably benign 0.05
IGL02317:Rabl2 APN 15 89584289 missense probably damaging 1.00
R0335:Rabl2 UTSW 15 89583966 missense probably damaging 1.00
R4169:Rabl2 UTSW 15 89590379 start codon destroyed probably null 0.98
R4330:Rabl2 UTSW 15 89586934 missense probably benign 0.09
R5657:Rabl2 UTSW 15 89588213 missense probably benign 0.00
R6242:Rabl2 UTSW 15 89584352 missense probably benign
X0023:Rabl2 UTSW 15 89583980 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGTCTGCTGCAGAGAGAAGTG -3'
(R):5'- TACCCTCTGTAGGTATTTGATGTCC -3'

Sequencing Primer
(F):5'- GGGGCATTGGCTTGTCCAC -3'
(R):5'- TTGATGTCCAGAGGAAAATCACC -3'
Posted On2015-06-20