Incidental Mutation 'R4276:Vmn2r93'
ID322721
Institutional Source Beutler Lab
Gene Symbol Vmn2r93
Ensembl Gene ENSMUSG00000079698
Gene Namevomeronasal 2, receptor 93
SynonymsEG627132
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18298099-18331914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18304830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 250 (I250T)
Ref Sequence ENSEMBL: ENSMUSP00000155900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079206] [ENSMUST00000231879] [ENSMUST00000231938]
Predicted Effect probably benign
Transcript: ENSMUST00000079206
AA Change: I250T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078200
Gene: ENSMUSG00000079698
AA Change: I250T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 453 5.9e-40 PFAM
Pfam:NCD3G 509 562 2.6e-21 PFAM
Pfam:7tm_3 594 830 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231879
AA Change: I250T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231938
AA Change: I250T

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Other mutations in Vmn2r93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Vmn2r93 APN 17 18326242 missense probably damaging 1.00
IGL01326:Vmn2r93 APN 17 18316644 missense possibly damaging 0.92
IGL01328:Vmn2r93 APN 17 18325557 missense probably benign 0.00
IGL01360:Vmn2r93 APN 17 18305248 missense possibly damaging 0.71
IGL01382:Vmn2r93 APN 17 18313316 nonsense probably null
IGL01463:Vmn2r93 APN 17 18304888 missense probably damaging 1.00
IGL02057:Vmn2r93 APN 17 18325770 missense probably damaging 1.00
IGL02257:Vmn2r93 APN 17 18325508 unclassified probably benign
IGL02686:Vmn2r93 APN 17 18313264 missense possibly damaging 0.89
IGL02720:Vmn2r93 APN 17 18305034 missense probably damaging 1.00
IGL03328:Vmn2r93 APN 17 18304958 missense probably damaging 1.00
PIT4576001:Vmn2r93 UTSW 17 18313211 missense probably benign
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0488:Vmn2r93 UTSW 17 18326049 missense probably damaging 1.00
R0667:Vmn2r93 UTSW 17 18326241 missense probably damaging 1.00
R0668:Vmn2r93 UTSW 17 18298405 missense probably benign 0.00
R0850:Vmn2r93 UTSW 17 18305017 missense possibly damaging 0.93
R0924:Vmn2r93 UTSW 17 18304181 missense probably benign
R0947:Vmn2r93 UTSW 17 18304081 missense probably benign 0.06
R1124:Vmn2r93 UTSW 17 18298448 missense probably benign 0.00
R1584:Vmn2r93 UTSW 17 18305151 missense possibly damaging 0.84
R1943:Vmn2r93 UTSW 17 18325801 missense probably benign 0.04
R2012:Vmn2r93 UTSW 17 18316578 missense probably benign 0.01
R2018:Vmn2r93 UTSW 17 18326062 missense probably damaging 1.00
R2196:Vmn2r93 UTSW 17 18305166 missense probably damaging 1.00
R2373:Vmn2r93 UTSW 17 18298403 missense probably benign
R2864:Vmn2r93 UTSW 17 18326061 missense probably damaging 1.00
R4446:Vmn2r93 UTSW 17 18304050 missense possibly damaging 0.93
R4537:Vmn2r93 UTSW 17 18304932 missense possibly damaging 0.86
R4674:Vmn2r93 UTSW 17 18304993 missense probably benign 0.34
R4726:Vmn2r93 UTSW 17 18316698 missense probably damaging 1.00
R4936:Vmn2r93 UTSW 17 18304065 missense possibly damaging 0.95
R4984:Vmn2r93 UTSW 17 18313127 splice site probably null
R5111:Vmn2r93 UTSW 17 18326064 missense probably damaging 0.99
R5749:Vmn2r93 UTSW 17 18298284 missense probably benign 0.06
R5918:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R5921:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R6091:Vmn2r93 UTSW 17 18325696 missense probably benign 0.06
R6283:Vmn2r93 UTSW 17 18304104 missense probably benign 0.02
R6680:Vmn2r93 UTSW 17 18316658 nonsense probably null
R6876:Vmn2r93 UTSW 17 18305188 missense probably benign 0.00
R6963:Vmn2r93 UTSW 17 18316587 missense probably damaging 1.00
R6996:Vmn2r93 UTSW 17 18304641 missense probably damaging 1.00
R7027:Vmn2r93 UTSW 17 18313286 missense probably benign 0.01
R7034:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7036:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7246:Vmn2r93 UTSW 17 18325750 missense possibly damaging 0.89
R7258:Vmn2r93 UTSW 17 18305141 missense probably benign 0.32
R7323:Vmn2r93 UTSW 17 18313235 nonsense probably null
R7325:Vmn2r93 UTSW 17 18303987 missense probably benign 0.01
R7390:Vmn2r93 UTSW 17 18305067 missense probably damaging 1.00
R7427:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7428:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7448:Vmn2r93 UTSW 17 18325986 missense probably benign 0.19
R7453:Vmn2r93 UTSW 17 18313318 missense probably benign 0.10
R7562:Vmn2r93 UTSW 17 18298469 missense probably benign 0.01
R7662:Vmn2r93 UTSW 17 18305369 missense probably benign 0.00
R7682:Vmn2r93 UTSW 17 18305321 missense probably benign 0.03
R7704:Vmn2r93 UTSW 17 18316648 missense probably benign 0.01
R7772:Vmn2r93 UTSW 17 18313220 missense probably damaging 0.99
R7957:Vmn2r93 UTSW 17 18325692 nonsense probably null
R8276:Vmn2r93 UTSW 17 18305387 critical splice donor site probably null
R8290:Vmn2r93 UTSW 17 18304029 missense probably damaging 1.00
R8362:Vmn2r93 UTSW 17 18326091 missense probably benign 0.02
R8376:Vmn2r93 UTSW 17 18304968 missense probably damaging 1.00
Z1088:Vmn2r93 UTSW 17 18326403 missense probably damaging 1.00
Z1177:Vmn2r93 UTSW 17 18305338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGTATTCTTCTCTCTACCAGATG -3'
(R):5'- AAGCTTCCATGGAATGAGTCTAAC -3'

Sequencing Primer
(F):5'- TCTACCAGATGGCTCCGCAG -3'
(R):5'- AGTGTTCATGACCCAGAC -3'
Posted On2015-06-20