Incidental Mutation 'R4276:Vegfa'
ID322723
Institutional Source Beutler Lab
Gene Symbol Vegfa
Ensembl Gene ENSMUSG00000023951
Gene Namevascular endothelial growth factor A
SynonymsVEGF-A, VPF, VEGF164, VEGF120, VEGF188, Vegf
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4276 (G1)
Quality Score155
Status Validated
Chromosome17
Chromosomal Location46016993-46032369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46031466 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000151185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024747] [ENSMUST00000071648] [ENSMUST00000113519] [ENSMUST00000113520] [ENSMUST00000142351] [ENSMUST00000167860] [ENSMUST00000214739] [ENSMUST00000217017]
Predicted Effect probably benign
Transcript: ENSMUST00000024747
SMART Domains Protein: ENSMUSP00000024747
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071648
AA Change: V142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071575
Gene: ENSMUSG00000023951
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 312 368 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113519
SMART Domains Protein: ENSMUSP00000109147
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
low complexity region 140 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113520
SMART Domains Protein: ENSMUSP00000109148
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Pfam:VEGF_C 154 208 9.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142351
AA Change: V142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115883
Gene: ENSMUSG00000023951
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 339 392 1.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146149
Predicted Effect probably benign
Transcript: ENSMUST00000167860
AA Change: V142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131901
Gene: ENSMUSG00000023951
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214739
AA Change: V142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217017
AA Change: V142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.[provided by RefSeq, Nov 2015]
PHENOTYPE: Hetero- or homozygous null mutants show embryonic lethality with impaired angiogenesis and blood-island formation. Mutants selectively expressing isoform 120 or 188 exhibit vascular outgrowth/patterning defects or impaired arterial development, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Vegfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Vegfa APN 17 46025421 missense possibly damaging 0.88
IGL02859:Vegfa APN 17 46024495 missense probably benign 0.43
R1442:Vegfa UTSW 17 46025492 missense possibly damaging 0.85
R1760:Vegfa UTSW 17 46025469 missense probably damaging 1.00
R1982:Vegfa UTSW 17 46018860 makesense probably null
R2012:Vegfa UTSW 17 46025358 missense probably benign 0.21
R3729:Vegfa UTSW 17 46024520 missense possibly damaging 0.80
R4277:Vegfa UTSW 17 46031466 missense probably benign
R4279:Vegfa UTSW 17 46031466 missense probably benign
R4654:Vegfa UTSW 17 46025250 intron probably benign
R4696:Vegfa UTSW 17 46028346 splice site probably null
R7798:Vegfa UTSW 17 46031835 missense probably damaging 1.00
R7863:Vegfa UTSW 17 46025535 missense probably damaging 1.00
R7946:Vegfa UTSW 17 46025451 missense probably damaging 0.96
R8235:Vegfa UTSW 17 46031310 missense possibly damaging 0.91
X0026:Vegfa UTSW 17 46025526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTTGGCATGGTGGAGGTAC -3'
(R):5'- GAAACTTTTCGTCCAACTTCTGGG -3'

Sequencing Primer
(F):5'- TACAGCAGTAAAGCCAGGGTCC -3'
(R):5'- CTGGGAGAAGTGCTAGCTCG -3'
Posted On2015-06-20