Mutagenetix > Incidental Mutations

Incidental Mutation 'R4277:Dstyk'

322731

Institutional Source

Beutler Lab

Gene Symbol

Dstyk

Ensembl Gene

ENSMUSG00000042046

Gene Name

dual serine/threonine and tyrosine protein kinase

Synonyms

C430014H23Rik, A930019K20Rik

MMRRC Submission

041078-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R4277 (G1)

Quality Score

112

Status

Validated

Chromosome

Chromosomal Location

132417555-132466958 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 132455413 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045110] [ENSMUST00000188389] [ENSMUST00000188389]

Predicted Effect

probably null
Transcript: ENSMUST00000045110

SMART Domains

Protein: ENSMUSP00000035358
Gene: ENSMUSG00000042046

Domain	Start	End	E-Value	Type
low complexity region	15	22	N/A	INTRINSIC
low complexity region	57	73	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	285	299	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
Pfam:Pkinase_Tyr	651	904	6.9e-37	PFAM
Pfam:Pkinase	651	905	5.1e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000187092

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188006

Predicted Effect

probably null
Transcript: ENSMUST00000188389

SMART Domains

Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046

Domain	Start	End	E-Value	Type
low complexity region	15	22	N/A	INTRINSIC
low complexity region	57	73	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	285	299	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
S_TKc	650	859	2e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000188389

SMART Domains

Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046

Domain	Start	End	E-Value	Type
low complexity region	15	22	N/A	INTRINSIC
low complexity region	57	73	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	285	299	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
S_TKc	650	859	2e-13	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous knockout results in impaired spatial learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Akr1b7	A	G	6: 34,421,020		probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Cdh7	T	A	1: 110,065,688	I291K	probably benign	Het
Cdhr3	T	G	12: 33,060,233	S351R	probably null	Het
Dnah10	T	C	5: 124,732,330	S221P	probably benign	Het
Ern1	T	C	11: 106,407,181	I705V	probably benign	Het
Folh1	A	G	7: 86,762,915		probably null	Het
Hemk1	A	G	9: 107,328,529	Y260H	possibly damaging	Het
Jmjd8	A	G	17: 25,829,813		probably benign	Het
Ldhc	G	A	7: 46,866,466	A62T	probably benign	Het
Ndufs1	C	T	1: 63,170,097	V36I	possibly damaging	Het
Nsun4	C	T	4: 116,034,282	G300D	probably damaging	Het
Nsun5	A	G	5: 135,370,060	Y26C	probably damaging	Het
Ntn4	T	C	10: 93,741,210	I580T	possibly damaging	Het
Olfr77	A	G	9: 19,920,389	Y60C	possibly damaging	Het
Rasal2	A	T	1: 157,157,126	I992N	possibly damaging	Het
Rasgrp4	T	A	7: 29,152,594		probably benign	Het
Rbp3	G	A	14: 33,958,650	V1070I	probably benign	Het
Spp2	T	C	1: 88,411,151	F79L	probably damaging	Het
Tmem260	C	T	14: 48,477,636	T249M	probably damaging	Het
Trpv3	A	G	11: 73,296,438	T699A	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vegfa	A	G	17: 46,031,466	V142A	probably benign	Het
Vnn1	A	T	10: 23,898,512	D151V	possibly damaging	Het

Other mutations in Dstyk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Dstyk	APN	1	132459988	missense	probably damaging	1.00
IGL01753:Dstyk	APN	1	132462939	missense	probably damaging	1.00
IGL02156:Dstyk	APN	1	132449926	missense	probably benign	0.27
IGL02175:Dstyk	APN	1	132449391	nonsense	probably null
IGL02721:Dstyk	APN	1	132449316	missense	probably benign	0.03
IGL03194:Dstyk	APN	1	132456316	splice site	probably benign
PIT4305001:Dstyk	UTSW	1	132455896	nonsense	probably null
PIT4791001:Dstyk	UTSW	1	132449927	missense	probably benign	0.00
R0135:Dstyk	UTSW	1	132462934	missense	probably damaging	1.00
R0309:Dstyk	UTSW	1	132456864	splice site	probably benign
R0399:Dstyk	UTSW	1	132453080	splice site	probably benign
R0781:Dstyk	UTSW	1	132453325	splice site	probably benign
R1110:Dstyk	UTSW	1	132453325	splice site	probably benign
R1138:Dstyk	UTSW	1	132463486	missense	probably benign	0.00
R1300:Dstyk	UTSW	1	132449913	missense	probably benign	0.02
R1330:Dstyk	UTSW	1	132449880	missense	probably benign	0.25
R1509:Dstyk	UTSW	1	132456346	missense	probably damaging	1.00
R1667:Dstyk	UTSW	1	132456919	missense	probably damaging	1.00
R1728:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1729:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1730:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1739:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1757:Dstyk	UTSW	1	132434094	splice site	probably benign
R1762:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1783:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1784:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1785:Dstyk	UTSW	1	132456984	missense	probably damaging	1.00
R1829:Dstyk	UTSW	1	132449595	missense	probably benign	0.06
R2031:Dstyk	UTSW	1	132453191	missense	probably damaging	0.99
R2124:Dstyk	UTSW	1	132453119	missense	possibly damaging	0.64
R2132:Dstyk	UTSW	1	132449484	missense	probably null
R2143:Dstyk	UTSW	1	132463375	missense	probably damaging	1.00
R2144:Dstyk	UTSW	1	132463375	missense	probably damaging	1.00
R2145:Dstyk	UTSW	1	132463375	missense	probably damaging	1.00
R3804:Dstyk	UTSW	1	132449726	missense	probably damaging	1.00
R4504:Dstyk	UTSW	1	132434389	missense	possibly damaging	0.81
R4674:Dstyk	UTSW	1	132463390	missense	probably benign	0.42
R4697:Dstyk	UTSW	1	132449487	missense	probably damaging	0.98
R4828:Dstyk	UTSW	1	132434137	missense	probably benign
R4940:Dstyk	UTSW	1	132453106	missense	probably damaging	0.96
R5029:Dstyk	UTSW	1	132449324	missense	probably benign	0.01
R5678:Dstyk	UTSW	1	132453291	missense	probably benign
R5900:Dstyk	UTSW	1	132456979	missense	probably damaging	1.00
R5935:Dstyk	UTSW	1	132454137	missense	probably damaging	0.99
R5973:Dstyk	UTSW	1	132434411	missense	probably damaging	0.99
R6217:Dstyk	UTSW	1	132459939	missense	probably damaging	1.00
R6381:Dstyk	UTSW	1	132456765	splice site	probably null
R6429:Dstyk	UTSW	1	132449804	nonsense	probably null
R7038:Dstyk	UTSW	1	132454109	missense	probably benign	0.32
R7240:Dstyk	UTSW	1	132454123	missense	probably benign	0.02
R7411:Dstyk	UTSW	1	132417666	missense	probably benign	0.01
R7714:Dstyk	UTSW	1	132456876	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATCATCCAGCGTATCACATGGG -3'
(R):5'- GAACAGAGTCAGGAAGTCACTCC -3'

Sequencing Primer
(F):5'- GTGAACCCACCCACCATC -3'
(R):5'- AGAGTCAGGAAGTCACTCCTCTTTC -3'

Posted On

2015-06-20