Incidental Mutation 'R4277:Vnn1'
ID322744
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Namevanin 1
SynonymsV-1, pantetheinase
MMRRC Submission 041078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4277 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23894688-23905343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23898512 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 151 (D151V)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041416
AA Change: D151V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: D151V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Akr1b7 A G 6: 34,421,020 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh7 T A 1: 110,065,688 I291K probably benign Het
Cdhr3 T G 12: 33,060,233 S351R probably null Het
Dnah10 T C 5: 124,732,330 S221P probably benign Het
Dstyk G A 1: 132,455,413 probably null Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Folh1 A G 7: 86,762,915 probably null Het
Hemk1 A G 9: 107,328,529 Y260H possibly damaging Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Ldhc G A 7: 46,866,466 A62T probably benign Het
Ndufs1 C T 1: 63,170,097 V36I possibly damaging Het
Nsun4 C T 4: 116,034,282 G300D probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Ntn4 T C 10: 93,741,210 I580T possibly damaging Het
Olfr77 A G 9: 19,920,389 Y60C possibly damaging Het
Rasal2 A T 1: 157,157,126 I992N possibly damaging Het
Rasgrp4 T A 7: 29,152,594 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Spp2 T C 1: 88,411,151 F79L probably damaging Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Trpv3 A G 11: 73,296,438 T699A probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23900779 missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23895051 missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23900840 missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23900710 missense probably benign 0.26
IGL01970:Vnn1 APN 10 23897402 missense probably benign 0.06
IGL01985:Vnn1 APN 10 23900744 missense probably benign 0.00
IGL02019:Vnn1 APN 10 23903551 missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23903425 missense probably benign 0.00
IGL02349:Vnn1 APN 10 23898503 missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23904622 missense probably benign 0.00
IGL03058:Vnn1 APN 10 23904544 missense probably benign 0.06
R0008:Vnn1 UTSW 10 23898602 critical splice donor site probably null
R0030:Vnn1 UTSW 10 23900846 missense probably benign 0.08
R0508:Vnn1 UTSW 10 23895012 missense probably benign 0.01
R0781:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23900828 missense possibly damaging 0.49
R1757:Vnn1 UTSW 10 23900829 missense probably benign 0.00
R1778:Vnn1 UTSW 10 23899517 missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23894971 nonsense probably null
R2055:Vnn1 UTSW 10 23900577 splice site probably benign
R2158:Vnn1 UTSW 10 23900755 nonsense probably null
R2186:Vnn1 UTSW 10 23897401 missense probably benign 0.29
R4279:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23894891 missense probably benign
R4590:Vnn1 UTSW 10 23899405 missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23897352 missense probably benign 0.01
R4794:Vnn1 UTSW 10 23900704 missense probably benign 0.01
R5266:Vnn1 UTSW 10 23903405 missense probably damaging 1.00
R5495:Vnn1 UTSW 10 23898564 missense probably damaging 0.98
R6064:Vnn1 UTSW 10 23894909 missense probably benign 0.05
R7081:Vnn1 UTSW 10 23895005 missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23900747 missense probably benign 0.00
R7221:Vnn1 UTSW 10 23895054 missense probably benign 0.07
R7334:Vnn1 UTSW 10 23900760 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTATTGGCGTCCTTTGAAGC -3'
(R):5'- AAATACTGCCCTCTCTGCTG -3'

Sequencing Primer
(F):5'- GCGTCCTTTGAAGCCTTTTG -3'
(R):5'- TGCTGTCACCACTCCACTCTAAAG -3'
Posted On2015-06-20