Incidental Mutation 'R4278:Slc27a3'
ID322757
Institutional Source Beutler Lab
Gene Symbol Slc27a3
Ensembl Gene ENSMUSG00000027932
Gene Namesolute carrier family 27 (fatty acid transporter), member 3
SynonymsAcsvl3, fatty acid transport protein 3, FATP3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90385239-90389938 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 90389188 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029541] [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect silent
Transcript: ENSMUST00000029541
SMART Domains Protein: ENSMUSP00000029541
Gene: ENSMUSG00000027932

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
Pfam:AMP-binding 138 535 9.2e-62 PFAM
Pfam:AMP-binding_C 543 619 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029542
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071488
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127064
Predicted Effect unknown
Transcript: ENSMUST00000132041
AA Change: R159H
SMART Domains Protein: ENSMUSP00000122599
Gene: ENSMUSG00000027932
AA Change: R159H

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 68 89 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:AMP-binding 147 501 5.3e-50 PFAM
Pfam:AMP-binding_C 509 585 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153978
Predicted Effect probably benign
Transcript: ENSMUST00000196530
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of integral membrane proteins and encodes a protein that is involved in lipid metabolism. The increased expression of this gene in human neural stem cells derived from induced pluripotent stem cells suggests that it plays an important role in early brain development. Naturally occurring mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Slc27a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Slc27a3 APN 3 90385441 nonsense probably null
IGL01080:Slc27a3 APN 3 90385460 missense probably benign 0.17
IGL01313:Slc27a3 APN 3 90386554 missense probably damaging 1.00
IGL01358:Slc27a3 APN 3 90386552 missense probably damaging 1.00
IGL02261:Slc27a3 APN 3 90387695 missense probably benign
R0557:Slc27a3 UTSW 3 90386856 missense probably damaging 1.00
R1922:Slc27a3 UTSW 3 90386317 missense probably benign
R2032:Slc27a3 UTSW 3 90387397 missense probably damaging 0.99
R3922:Slc27a3 UTSW 3 90387085 missense possibly damaging 0.65
R4432:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4433:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4672:Slc27a3 UTSW 3 90387646 missense possibly damaging 0.90
R5183:Slc27a3 UTSW 3 90389170 critical splice donor site probably null
R5201:Slc27a3 UTSW 3 90389219 missense probably benign 0.41
R5328:Slc27a3 UTSW 3 90386832 missense probably damaging 1.00
R5405:Slc27a3 UTSW 3 90387075 missense probably benign 0.05
R5477:Slc27a3 UTSW 3 90386839 missense probably benign
R5743:Slc27a3 UTSW 3 90387072 missense probably benign 0.38
R6344:Slc27a3 UTSW 3 90387654 nonsense probably null
R6450:Slc27a3 UTSW 3 90385470 missense probably damaging 0.97
R6988:Slc27a3 UTSW 3 90386290 missense probably benign 0.01
R7204:Slc27a3 UTSW 3 90389726 missense probably benign 0.07
R7736:Slc27a3 UTSW 3 90389433 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCAATGCTCTAGGGTGAGG -3'
(R):5'- TGGAGATGCGGCTGCTAGAG -3'

Sequencing Primer
(F):5'- TGGCAATGTGGGGATCCC -3'
(R):5'- TGCTAGAGGGACGACCG -3'
Posted On2015-06-20