Incidental Mutation 'R4278:Il22ra1'
ID322760
Institutional Source Beutler Lab
Gene Symbol Il22ra1
Ensembl Gene ENSMUSG00000037157
Gene Nameinterleukin 22 receptor, alpha 1
SynonymsIl22r
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135728172-135752140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135750713 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 365 (A365V)
Ref Sequence ENSEMBL: ENSMUSP00000099605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102546
AA Change: A365V

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099605
Gene: ENSMUSG00000037157
AA Change: A365V

DomainStartEndE-ValueType
Pfam:Tissue_fac 4 106 1.1e-29 PFAM
Pfam:Interfer-bind 119 214 7.5e-7 PFAM
transmembrane domain 227 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family, and has been shown to be a receptor for interleukin 22 (IL22). IL22 receptor is a protein complex that consists of this protein and interleukin 10 receptor, beta (IL10BR/CRFB4), a subunit also shared by the receptor complex for interleukin 10 (IL10). This gene and interleukin 28 receptor, alpha (IL28RA) form a cytokine receptor gene cluster in the chromosomal region 1p36. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Il22ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Il22ra1 APN 4 135751084 missense possibly damaging 0.84
IGL01480:Il22ra1 APN 4 135744801 missense probably benign 0.03
IGL02533:Il22ra1 APN 4 135744723 missense possibly damaging 0.94
R0137:Il22ra1 UTSW 4 135751006 missense probably benign 0.00
R0196:Il22ra1 UTSW 4 135734245 missense possibly damaging 0.67
R1647:Il22ra1 UTSW 4 135750460 missense probably damaging 0.98
R1800:Il22ra1 UTSW 4 135748160 missense probably benign 0.10
R1901:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1902:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1903:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1906:Il22ra1 UTSW 4 135751233 missense probably damaging 1.00
R4404:Il22ra1 UTSW 4 135737431 missense possibly damaging 0.56
R5001:Il22ra1 UTSW 4 135733104 missense probably damaging 1.00
R6666:Il22ra1 UTSW 4 135750461 missense probably damaging 0.98
R7054:Il22ra1 UTSW 4 135751162 missense probably benign 0.00
R7615:Il22ra1 UTSW 4 135737459 missense probably benign 0.16
R7644:Il22ra1 UTSW 4 135733035 missense probably damaging 1.00
R7754:Il22ra1 UTSW 4 135734250 missense probably benign 0.01
R7808:Il22ra1 UTSW 4 135750796 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CATCCAGTACTCCCAAGTGGTG -3'
(R):5'- TTCCTGGAGCTGACCTTTTG -3'

Sequencing Primer
(F):5'- GTGGTGTCTGGGCCCAG -3'
(R):5'- CCTGGAGCTGACCTTTTGTCTTG -3'
Posted On2015-06-20