Incidental Mutation 'R4278:Nsun5'
ID322763
Institutional Source Beutler Lab
Gene Symbol Nsun5
Ensembl Gene ENSMUSG00000000916
Gene NameNOL1/NOP2/Sun domain family, member 5
Synonyms9830109N13Rik, Nol1r, Wbscr20a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4278 (G1)
Quality Score209
Status Not validated
Chromosome5
Chromosomal Location135369953-135376805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135370060 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 26 (Y26C)
Ref Sequence ENSEMBL: ENSMUSP00000128370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000940] [ENSMUST00000065785] [ENSMUST00000111180] [ENSMUST00000170342]
Predicted Effect probably damaging
Transcript: ENSMUST00000000940
AA Change: Y26C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000940
Gene: ENSMUSG00000000916
AA Change: Y26C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 180 189 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 219 423 1.1e-32 PFAM
low complexity region 448 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065785
SMART Domains Protein: ENSMUSP00000066662
Gene: ENSMUSG00000053388

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 292 344 1.07e-13 SMART
SPRY 345 473 7.48e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111180
SMART Domains Protein: ENSMUSP00000106811
Gene: ENSMUSG00000053388

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 293 345 1.07e-13 SMART
SPRY 346 474 7.48e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141867
Predicted Effect probably damaging
Transcript: ENSMUST00000170342
AA Change: Y26C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128370
Gene: ENSMUSG00000000916
AA Change: Y26C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202422
AA Change: Y23C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202792
Meta Mutation Damage Score 0.2980 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved family of proteins that may function as methyltransferases. This gene is located in a larger region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. There are two pseudogenes for this gene located in the same region of chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Nsun5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nsun5 APN 5 135375395 missense possibly damaging 0.69
IGL01797:Nsun5 APN 5 135375371 missense probably damaging 1.00
IGL01817:Nsun5 APN 5 135370039 missense probably damaging 1.00
IGL03233:Nsun5 APN 5 135375445 missense probably damaging 1.00
PIT4382001:Nsun5 UTSW 5 135371501 missense probably benign
R1436:Nsun5 UTSW 5 135370213 missense probably damaging 1.00
R1710:Nsun5 UTSW 5 135371316 missense probably damaging 1.00
R1919:Nsun5 UTSW 5 135375598 missense probably benign 0.00
R2067:Nsun5 UTSW 5 135375072 missense probably damaging 1.00
R2937:Nsun5 UTSW 5 135375463 nonsense probably null
R2938:Nsun5 UTSW 5 135375463 nonsense probably null
R4277:Nsun5 UTSW 5 135370060 missense probably damaging 1.00
R5732:Nsun5 UTSW 5 135371350 missense probably damaging 1.00
R6261:Nsun5 UTSW 5 135371531 missense probably damaging 1.00
R6525:Nsun5 UTSW 5 135375058 missense probably damaging 1.00
R6922:Nsun5 UTSW 5 135370192 missense probably damaging 0.98
R7110:Nsun5 UTSW 5 135371250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTTGACTCCGGAAATC -3'
(R):5'- CATCTGACCCAGCTCAACTG -3'

Sequencing Primer
(F):5'- GGAAATCCGGTTGTACAAATTGTTGC -3'
(R):5'- TTCTTCTCGGCGCGAAG -3'
Posted On2015-06-20