Incidental Mutation 'R4278:Capza3'
ID322764
Institutional Source Beutler Lab
Gene Symbol Capza3
Ensembl Gene ENSMUSG00000041791
Gene Namecapping protein (actin filament) muscle Z-line, alpha 3
SynonymsGsg3, repro32, 510-4, Tex8, cp alpha3, Cappa3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location140041252-140042778 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 140042060 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 128 (Y128*)
Ref Sequence ENSEMBL: ENSMUSP00000038562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000043797] [ENSMUST00000129986] [ENSMUST00000137148] [ENSMUST00000149931]
Predicted Effect probably benign
Transcript: ENSMUST00000032356
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000043797
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000038562
Gene: ENSMUSG00000041791
AA Change: Y128*

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 12 278 7.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Predicted Effect probably benign
Transcript: ENSMUST00000149931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204342
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin capping protein, one of the F-actin capping protein alpha subunit family. The encoded protein is predominantly localized to the neck region of ejaculated sperm, other immunohistochemical signals were found in the tail and postacrosomal regions. The encoded protein may also form heterodimers of alpha and beta subunits. This protein may be important in determining sperm architecture and male fertility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for an ENU-induced mutation are infertile, exhibit low epididymal sperm concentrations, and produce sperm with abnormally shaped heads and poor motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Capza3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Capza3 APN 6 140042146 missense probably benign
IGL02228:Capza3 APN 6 140041915 missense probably benign
R1953:Capza3 UTSW 6 140042568 missense possibly damaging 0.59
R4272:Capza3 UTSW 6 140042538 missense probably benign 0.33
R4421:Capza3 UTSW 6 140042042 missense probably benign
R5504:Capza3 UTSW 6 140042439 missense probably benign 0.42
R7070:Capza3 UTSW 6 140041920 missense probably damaging 1.00
R7661:Capza3 UTSW 6 140041772 missense probably benign 0.07
R8881:Capza3 UTSW 6 140041795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTCACCACAATGTGATGG -3'
(R):5'- AAGCTCTCCTTTAGGTCCTTGG -3'

Sequencing Primer
(F):5'- CACCACAATGTGATGGGTGACTTC -3'
(R):5'- CACAAAAATTCTCCCTGTGACTTGGG -3'
Posted On2015-06-20