Incidental Mutation 'R4278:Vmn1r80'
ID322765
Institutional Source Beutler Lab
Gene Symbol Vmn1r80
Ensembl Gene ENSMUSG00000115744
Gene Namevomeronasal 1 receptor 80
SynonymsV1rg3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12189286-12203313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12193527 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 188 (C188F)
Ref Sequence ENSEMBL: ENSMUSP00000153967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075053] [ENSMUST00000227205] [ENSMUST00000227471] [ENSMUST00000227755] [ENSMUST00000228028] [ENSMUST00000228578]
Predicted Effect probably benign
Transcript: ENSMUST00000075053
AA Change: C188F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074564
Gene: ENSMUSG00000115744
AA Change: C188F

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 5.4e-11 PFAM
Pfam:7tm_1 23 290 5.3e-7 PFAM
Pfam:V1R 31 298 3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227205
AA Change: C188F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227240
Predicted Effect probably benign
Transcript: ENSMUST00000227471
AA Change: C188F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227755
AA Change: C188F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228028
AA Change: C188F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228563
Predicted Effect probably benign
Transcript: ENSMUST00000228578
AA Change: C188F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Vmn1r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Vmn1r80 APN 7 12193380 missense possibly damaging 0.69
IGL01652:Vmn1r80 APN 7 12193136 missense probably benign 0.19
IGL02102:Vmn1r80 APN 7 12193691 missense probably damaging 1.00
IGL02165:Vmn1r80 APN 7 12193452 missense probably benign 0.31
IGL02328:Vmn1r80 APN 7 12193478 missense probably benign 0.12
IGL02336:Vmn1r80 APN 7 12193254 missense probably benign 0.23
IGL02606:Vmn1r80 APN 7 12193032 missense probably damaging 1.00
R0310:Vmn1r80 UTSW 7 12193848 missense probably benign 0.00
R0399:Vmn1r80 UTSW 7 12193317 missense possibly damaging 0.88
R1983:Vmn1r80 UTSW 7 12193661 missense probably benign 0.01
R2079:Vmn1r80 UTSW 7 12193194 missense probably damaging 1.00
R4501:Vmn1r80 UTSW 7 12193391 missense probably benign 0.39
R5894:Vmn1r80 UTSW 7 12193727 missense probably damaging 0.99
R5991:Vmn1r80 UTSW 7 12193496 missense probably benign 0.09
R6552:Vmn1r80 UTSW 7 12193757 missense probably damaging 0.98
R7560:Vmn1r80 UTSW 7 12193823 missense probably damaging 0.98
R7659:Vmn1r80 UTSW 7 12193050 missense probably damaging 1.00
R8313:Vmn1r80 UTSW 7 12193067 missense probably benign 0.00
Z1189:Vmn1r80 UTSW 7 12193433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGCCACCAAGTACCTTG -3'
(R):5'- TAACGATGGCCACCATGGAG -3'

Sequencing Primer
(F):5'- AAGTACCTTGGTCCCTCTTGC -3'
(R):5'- TGGCCACCATGGAGGAGAATG -3'
Posted On2015-06-20