Incidental Mutation 'R4278:Hhatl'
ID322770
Institutional Source Beutler Lab
Gene Symbol Hhatl
Ensembl Gene ENSMUSG00000032523
Gene Namehedgehog acyltransferase-like
SynonymsGup1, 1110011D13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location121784016-121792507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121784219 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 470 (A470V)
Ref Sequence ENSEMBL: ENSMUSP00000131971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000098272] [ENSMUST00000163981]
Predicted Effect probably benign
Transcript: ENSMUST00000035110
AA Change: A470V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523
AA Change: A470V

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098272
SMART Domains Protein: ENSMUSP00000095873
Gene: ENSMUSG00000074001

DomainStartEndE-ValueType
BTB 33 128 4.61e-29 SMART
BACK 133 239 9.46e-30 SMART
low complexity region 262 276 N/A INTRINSIC
Blast:BTB 300 355 2e-27 BLAST
Kelch 360 412 1.77e0 SMART
Kelch 413 462 1.29e-2 SMART
Kelch 463 510 4.68e-9 SMART
Kelch 511 557 2.06e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163981
AA Change: A470V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523
AA Change: A470V

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Hhatl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Hhatl APN 9 121789791 missense probably benign 0.21
R0270:Hhatl UTSW 9 121784720 missense probably benign 0.14
R0399:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0417:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0436:Hhatl UTSW 9 121788762 missense probably benign 0.00
R1741:Hhatl UTSW 9 121789059 missense possibly damaging 0.67
R2250:Hhatl UTSW 9 121788171 missense possibly damaging 0.67
R2284:Hhatl UTSW 9 121789582 missense probably damaging 1.00
R2513:Hhatl UTSW 9 121789170 missense probably benign 0.13
R4717:Hhatl UTSW 9 121789877 missense probably damaging 1.00
R4851:Hhatl UTSW 9 121789011 missense probably damaging 1.00
R5759:Hhatl UTSW 9 121788277 missense probably damaging 1.00
R6330:Hhatl UTSW 9 121788225 unclassified probably null
R6387:Hhatl UTSW 9 121790401 missense probably benign 0.09
R6460:Hhatl UTSW 9 121789522 missense probably benign 0.32
R6541:Hhatl UTSW 9 121785144 missense probably damaging 1.00
R6651:Hhatl UTSW 9 121784702 missense probably damaging 1.00
R6670:Hhatl UTSW 9 121789071 missense probably damaging 0.96
R6914:Hhatl UTSW 9 121788180 missense probably benign
R6942:Hhatl UTSW 9 121788180 missense probably benign
R7026:Hhatl UTSW 9 121788273 missense probably benign 0.26
R7251:Hhatl UTSW 9 121785050 critical splice donor site probably null
R7323:Hhatl UTSW 9 121789586 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTATTGGTCAGGCTCCGTG -3'
(R):5'- GGATCTACCTAACACACGGG -3'

Sequencing Primer
(F):5'- CCAGAAGCAGCTGAGCAGA -3'
(R):5'- TCCAAGGGACTCAGCAGG -3'
Posted On2015-06-20