Incidental Mutation 'R4278:Uhrf1bp1l'
ID 322771
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1l
Ensembl Gene ENSMUSG00000019951
Gene Name UHRF1 (ICBP90) binding protein 1-like
Synonyms 4930506D01Rik, E030041M21Rik, 2010319N22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock # R4278 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 89744991-89819871 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 89806709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020112] [ENSMUST00000218607] [ENSMUST00000218607] [ENSMUST00000218607] [ENSMUST00000220375]
AlphaFold A2RSJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000020112
AA Change: S1111A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020112
Gene: ENSMUSG00000019951
AA Change: S1111A

DomainStartEndE-ValueType
Pfam:Chorein_N 1 103 9.3e-21 PFAM
SCOP:d1c52__ 243 304 5e-3 SMART
low complexity region 788 801 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
coiled coil region 1410 1455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218607
Predicted Effect probably null
Transcript: ENSMUST00000218607
Predicted Effect probably null
Transcript: ENSMUST00000218607
Predicted Effect probably benign
Transcript: ENSMUST00000218776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219749
Predicted Effect probably benign
Transcript: ENSMUST00000220375
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Uhrf1bp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Uhrf1bp1l APN 10 89779984 missense probably damaging 1.00
IGL01102:Uhrf1bp1l APN 10 89791378 missense probably benign 0.00
IGL01457:Uhrf1bp1l APN 10 89805762 missense probably benign 0.06
IGL01647:Uhrf1bp1l APN 10 89774120 critical splice donor site probably null
IGL02552:Uhrf1bp1l APN 10 89806743 nonsense probably null
IGL02686:Uhrf1bp1l APN 10 89805193 missense probably benign
miscreant UTSW 10 89779963 missense probably damaging 0.97
scofflaw UTSW 10 89805684 missense probably benign 0.01
R0019:Uhrf1bp1l UTSW 10 89775969 missense probably damaging 1.00
R0505:Uhrf1bp1l UTSW 10 89791443 missense probably damaging 1.00
R0746:Uhrf1bp1l UTSW 10 89805454 missense probably benign 0.37
R1255:Uhrf1bp1l UTSW 10 89745270 missense probably damaging 0.98
R1385:Uhrf1bp1l UTSW 10 89790641 missense possibly damaging 0.92
R1720:Uhrf1bp1l UTSW 10 89782586 missense probably damaging 1.00
R2142:Uhrf1bp1l UTSW 10 89812048 missense probably damaging 1.00
R2312:Uhrf1bp1l UTSW 10 89781133 missense probably damaging 0.99
R2986:Uhrf1bp1l UTSW 10 89806069 missense probably benign 0.00
R4063:Uhrf1bp1l UTSW 10 89816055 missense probably benign 0.38
R4854:Uhrf1bp1l UTSW 10 89794484 missense probably damaging 1.00
R4857:Uhrf1bp1l UTSW 10 89779963 missense probably damaging 0.97
R5135:Uhrf1bp1l UTSW 10 89789355 missense probably damaging 1.00
R5467:Uhrf1bp1l UTSW 10 89805099 missense probably damaging 1.00
R5567:Uhrf1bp1l UTSW 10 89808521 missense probably benign 0.18
R5767:Uhrf1bp1l UTSW 10 89787199 missense possibly damaging 0.68
R6191:Uhrf1bp1l UTSW 10 89805318 missense possibly damaging 0.78
R6196:Uhrf1bp1l UTSW 10 89805333 missense probably benign 0.00
R6387:Uhrf1bp1l UTSW 10 89803057 nonsense probably null
R6729:Uhrf1bp1l UTSW 10 89805684 missense probably benign 0.01
R6746:Uhrf1bp1l UTSW 10 89787158 missense probably benign 0.19
R6794:Uhrf1bp1l UTSW 10 89805762 missense probably benign 0.06
R6892:Uhrf1bp1l UTSW 10 89805123 missense probably benign 0.02
R6990:Uhrf1bp1l UTSW 10 89806117 missense probably benign 0.12
R7188:Uhrf1bp1l UTSW 10 89779882 missense probably damaging 0.96
R7226:Uhrf1bp1l UTSW 10 89808641 missense probably benign 0.00
R7376:Uhrf1bp1l UTSW 10 89809656 missense probably damaging 1.00
R7836:Uhrf1bp1l UTSW 10 89816106 missense probably benign 0.00
R8188:Uhrf1bp1l UTSW 10 89812066 missense possibly damaging 0.50
R8343:Uhrf1bp1l UTSW 10 89791419 missense probably benign
R8356:Uhrf1bp1l UTSW 10 89812092 missense probably benign 0.00
R8367:Uhrf1bp1l UTSW 10 89805377 missense probably damaging 1.00
R8391:Uhrf1bp1l UTSW 10 89809743 missense possibly damaging 0.58
R8456:Uhrf1bp1l UTSW 10 89812092 missense probably benign 0.00
R8546:Uhrf1bp1l UTSW 10 89794535 missense probably damaging 1.00
R8728:Uhrf1bp1l UTSW 10 89782720 missense probably benign 0.00
R8816:Uhrf1bp1l UTSW 10 89790735 critical splice donor site probably benign
R9138:Uhrf1bp1l UTSW 10 89779876 missense probably damaging 1.00
R9220:Uhrf1bp1l UTSW 10 89790595 missense probably benign 0.29
X0060:Uhrf1bp1l UTSW 10 89805379 missense probably damaging 0.98
Z1177:Uhrf1bp1l UTSW 10 89812072 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACTACACGCTGGCTTCCTTG -3'
(R):5'- GAACTGAGTCATTCTGTCTGTCC -3'

Sequencing Primer
(F):5'- CCGCAGTTCTGGGATTCC -3'
(R):5'- CCATTCGATGTCATTAATAAGCGTGG -3'
Posted On 2015-06-20