Incidental Mutation 'R4278:Rhbdd3'
ID322772
Institutional Source Beutler Lab
Gene Symbol Rhbdd3
Ensembl Gene ENSMUSG00000034175
Gene Namerhomboid domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5098926-5106093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5105329 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 226 (T226I)
Ref Sequence ENSEMBL: ENSMUSP00000105504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036320] [ENSMUST00000062821] [ENSMUST00000101610] [ENSMUST00000109878] [ENSMUST00000134267] [ENSMUST00000139742] [ENSMUST00000148761] [ENSMUST00000150632] [ENSMUST00000163299]
Predicted Effect probably benign
Transcript: ENSMUST00000036320
SMART Domains Protein: ENSMUSP00000044703
Gene: ENSMUSG00000034175

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 185 2.2e-7 PFAM
SCOP:d1ifya_ 308 351 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062821
SMART Domains Protein: ENSMUSP00000061704
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 101 8.7e-18 PFAM
low complexity region 200 211 N/A INTRINSIC
low complexity region 220 267 N/A INTRINSIC
Pfam:Collagen 282 342 5e-10 PFAM
Pfam:Collagen 312 377 4.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101610
AA Change: T226I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099131
Gene: ENSMUSG00000034175
AA Change: T226I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 2.5e-7 PFAM
Pfam:UBA 323 358 3.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109878
AA Change: T226I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105504
Gene: ENSMUSG00000034175
AA Change: T226I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 2e-7 PFAM
SCOP:d1ifya_ 318 361 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132196
Predicted Effect probably benign
Transcript: ENSMUST00000132328
SMART Domains Protein: ENSMUSP00000117779
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
low complexity region 1 44 N/A INTRINSIC
Pfam:Collagen 59 113 4.5e-10 PFAM
Pfam:Collagen 89 152 2e-13 PFAM
low complexity region 154 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137370
Predicted Effect probably benign
Transcript: ENSMUST00000139742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146879
Predicted Effect probably benign
Transcript: ENSMUST00000148761
SMART Domains Protein: ENSMUSP00000120264
Gene: ENSMUSG00000034175

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150632
Predicted Effect probably benign
Transcript: ENSMUST00000151906
SMART Domains Protein: ENSMUSP00000124014
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 2 68 8.4e-14 PFAM
low complexity region 72 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153308
SMART Domains Protein: ENSMUSP00000125605
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 1 49 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163299
SMART Domains Protein: ENSMUSP00000131391
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 33 101 7.3e-24 PFAM
low complexity region 198 209 N/A INTRINSIC
low complexity region 218 265 N/A INTRINSIC
Pfam:Collagen 280 340 5.1e-10 PFAM
Pfam:Collagen 310 375 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered stimulated NK cell activation and acute inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Rhbdd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Rhbdd3 APN 11 5105424 unclassified probably benign
IGL02376:Rhbdd3 APN 11 5103192 unclassified probably benign
R1387:Rhbdd3 UTSW 11 5104121 missense probably damaging 1.00
R1438:Rhbdd3 UTSW 11 5103332 missense probably damaging 1.00
R4196:Rhbdd3 UTSW 11 5099460 unclassified probably benign
R4554:Rhbdd3 UTSW 11 5105946 missense probably benign 0.03
R4809:Rhbdd3 UTSW 11 5105949 missense probably damaging 0.99
R5594:Rhbdd3 UTSW 11 5105710 missense probably damaging 1.00
R5687:Rhbdd3 UTSW 11 5105707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGGCCTTTATCCCACG -3'
(R):5'- TTCCATGTCAGCTGTCCAGG -3'

Sequencing Primer
(F):5'- ATGGCCTTTATCCCACGTCATC -3'
(R):5'- CGTGGTGGGAGCTGAGCAG -3'
Posted On2015-06-20