Incidental Mutation 'R4278:Pitpnm3'
ID322773
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene NamePITPNM family member 3
SynonymsAckr6, A330068P14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72047528-72135778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72074516 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 164 (V164I)
Ref Sequence ENSEMBL: ENSMUSP00000074737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
Predicted Effect probably damaging
Transcript: ENSMUST00000075258
AA Change: V164I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: V164I

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108508
AA Change: V148I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: V148I

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142471
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72112251 splice site probably benign
IGL01871:Pitpnm3 APN 11 72056138 missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72120139 missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 72071448 missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 72051858 missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 72058072 missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 72061466 splice site probably benign
IGL02946:Pitpnm3 APN 11 72092552 missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72120186 splice site probably benign
IGL03173:Pitpnm3 APN 11 72092563 missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 72070890 nonsense probably null
Frank UTSW 11 72070396 missense probably benign
Mickey UTSW 11 72070964 missense probably damaging 1.00
Stuart UTSW 11 72051929 missense probably null 0.99
R0102:Pitpnm3 UTSW 11 72056246 missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 72070492 splice site probably benign
R0964:Pitpnm3 UTSW 11 72058470 missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 72074627 missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 72058959 splice site probably null
R1951:Pitpnm3 UTSW 11 72074624 missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72112284 missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 72051959 missense possibly damaging 0.96
R4928:Pitpnm3 UTSW 11 72063172 missense probably damaging 1.00
R5543:Pitpnm3 UTSW 11 72056197 missense probably damaging 0.99
R5626:Pitpnm3 UTSW 11 72112332 missense probably benign 0.04
R5635:Pitpnm3 UTSW 11 72067160 missense possibly damaging 0.95
R5958:Pitpnm3 UTSW 11 72112367 splice site probably null
R6531:Pitpnm3 UTSW 11 72071487 missense possibly damaging 0.94
R6634:Pitpnm3 UTSW 11 72051929 missense probably null 0.99
R6764:Pitpnm3 UTSW 11 72051233 missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 72070396 missense probably benign
R7132:Pitpnm3 UTSW 11 72051276 missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 72070964 missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 72051182 missense probably benign 0.02
R7771:Pitpnm3 UTSW 11 72061488 nonsense probably null
X0018:Pitpnm3 UTSW 11 72071440 missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 72067108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGACTTGACACCAGACAGG -3'
(R):5'- TTTCTGGATGCACCTAGCCC -3'

Sequencing Primer
(F):5'- CAGACAGGCCTCAGCAGATG -3'
(R):5'- TGTCCTTGAGCACCCTGGATG -3'
Posted On2015-06-20