Incidental Mutation 'R4278:Sptlc2'
ID322775
Institutional Source Beutler Lab
Gene Symbol Sptlc2
Ensembl Gene ENSMUSG00000021036
Gene Nameserine palmitoyltransferase, long chain base subunit 2
SynonymsLCB2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87305058-87388355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87336151 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 393 (I393R)
Ref Sequence ENSEMBL: ENSMUSP00000021424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021424]
Predicted Effect probably benign
Transcript: ENSMUST00000021424
AA Change: I393R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036
AA Change: I393R

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 166 526 7.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181175
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Sptlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Sptlc2 APN 12 87369068 missense probably damaging 0.99
IGL02458:Sptlc2 APN 12 87309893 utr 3 prime probably benign
IGL02734:Sptlc2 APN 12 87355670 missense probably damaging 0.97
IGL03252:Sptlc2 APN 12 87355657 missense probably benign 0.00
lopsided UTSW 12 87341565 missense probably benign 0.27
shinola UTSW 12 87350295 missense possibly damaging 0.64
R0087:Sptlc2 UTSW 12 87369118 missense probably benign
R0116:Sptlc2 UTSW 12 87356680 missense probably benign 0.00
R0492:Sptlc2 UTSW 12 87346806 splice site probably null
R1353:Sptlc2 UTSW 12 87341746 missense probably damaging 1.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R3417:Sptlc2 UTSW 12 87346808 splice site probably benign
R3735:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R3736:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R5252:Sptlc2 UTSW 12 87336055 missense possibly damaging 0.49
R5593:Sptlc2 UTSW 12 87369083 missense probably benign 0.11
R5656:Sptlc2 UTSW 12 87346761 missense probably damaging 1.00
R5801:Sptlc2 UTSW 12 87341771 splice site probably null
R6256:Sptlc2 UTSW 12 87355531 missense probably damaging 1.00
R6280:Sptlc2 UTSW 12 87388131 missense probably benign
R6520:Sptlc2 UTSW 12 87355662 missense probably benign
R6808:Sptlc2 UTSW 12 87350295 missense possibly damaging 0.64
R7133:Sptlc2 UTSW 12 87350377 missense probably benign 0.00
R7274:Sptlc2 UTSW 12 87341606 missense probably benign 0.24
R7366:Sptlc2 UTSW 12 87314049 critical splice donor site probably null
R7602:Sptlc2 UTSW 12 87341689 missense probably damaging 0.99
Z1177:Sptlc2 UTSW 12 87369044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCTGACTCCTTATTTAGGG -3'
(R):5'- TGACCTAACCTTGGCTTTGC -3'

Sequencing Primer
(F):5'- CAGCACAATTGGCTGCTAAG -3'
(R):5'- GGCTTTGCCCTGTTTCTGGC -3'
Posted On2015-06-20