Incidental Mutation 'R4278:Kctd6'
ID322778
Institutional Source Beutler Lab
Gene Symbol Kctd6
Ensembl Gene ENSMUSG00000021752
Gene Namepotassium channel tetramerisation domain containing 6
Synonyms5430433B02Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location8214140-8223563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 8222806 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 216 (R216P)
Ref Sequence ENSEMBL: ENSMUSP00000129059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000022272] [ENSMUST00000164598] [ENSMUST00000170111]
Predicted Effect probably benign
Transcript: ENSMUST00000022271
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022272
AA Change: R216P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022272
Gene: ENSMUSG00000021752
AA Change: R216P

DomainStartEndE-ValueType
BTB 12 113 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164598
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170111
AA Change: R216P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129059
Gene: ENSMUSG00000021752
AA Change: R216P

DomainStartEndE-ValueType
BTB 12 113 1.29e-9 SMART
Meta Mutation Damage Score 0.2412 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Kctd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kctd6 APN 14 8222856 missense possibly damaging 0.58
IGL01121:Kctd6 APN 14 8222656 missense possibly damaging 0.92
R1735:Kctd6 UTSW 14 8222253 missense probably damaging 1.00
R2100:Kctd6 UTSW 14 8222239 missense possibly damaging 0.90
R2167:Kctd6 UTSW 14 8222683 missense probably benign
R4276:Kctd6 UTSW 14 8222806 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTCCACTCCTTACTCGAAG -3'
(R):5'- CACACAAAACTTCCTTCTGGTC -3'

Sequencing Primer
(F):5'- GCATCTCAAACTATTTCACCAAGTGG -3'
(R):5'- TGAGCTTGCAGGAAGTTC -3'
Posted On2015-06-20