Incidental Mutation 'R4278:Igfals'
ID322782
Institutional Source Beutler Lab
Gene Symbol Igfals
Ensembl Gene ENSMUSG00000046070
Gene Nameinsulin-like growth factor binding protein, acid labile subunit
SynonymsALS, Albs
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4278 (G1)
Quality Score163
Status Not validated
Chromosome17
Chromosomal Location24878770-24882008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24881217 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 427 (E427D)
Ref Sequence ENSEMBL: ENSMUSP00000060169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044252] [ENSMUST00000050714]
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050714
AA Change: E427D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070
AA Change: E427D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene gain weight more slowly after birth and display less growth in long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Igfals
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Igfals APN 17 24881660 missense probably benign 0.08
IGL01796:Igfals APN 17 24880082 missense probably damaging 0.96
IGL02448:Igfals APN 17 24880187 missense probably damaging 1.00
R1022:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1024:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1127:Igfals UTSW 17 24880481 missense probably damaging 1.00
R1653:Igfals UTSW 17 24881078 missense probably benign 0.00
R1827:Igfals UTSW 17 24880304 missense probably benign 0.20
R3872:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3873:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3874:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R5360:Igfals UTSW 17 24880093 missense probably benign 0.00
R5417:Igfals UTSW 17 24880316 missense probably damaging 1.00
R5654:Igfals UTSW 17 24881465 missense probably benign 0.23
R6261:Igfals UTSW 17 24881365 missense possibly damaging 0.88
R7061:Igfals UTSW 17 24880307 missense probably damaging 1.00
R7223:Igfals UTSW 17 24881234 missense probably damaging 1.00
R7484:Igfals UTSW 17 24879988 missense possibly damaging 0.95
R7699:Igfals UTSW 17 24880574 missense probably damaging 1.00
R7700:Igfals UTSW 17 24880574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTCTCCGGCAACTGTCTG -3'
(R):5'- CCCAGAGATGAGAAAAGGCCTTC -3'

Sequencing Primer
(F):5'- AACTGTCTGAGGAGCCTCC -3'
(R):5'- TGTGTGAGAGGTCCAGCCAG -3'
Posted On2015-06-20