Mutagenetix > Incidental Mutations

Incidental Mutation 'R4278:Vwa2'

322785

Institutional Source

Beutler Lab

Gene Symbol

Vwa2

Ensembl Gene

ENSMUSG00000025082

Gene Name

von Willebrand factor A domain containing 2

Synonyms

Amaco

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4278 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56874249-56912078 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 56903483 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 283 (Q283K)

Ref Sequence

ENSEMBL: ENSMUSP00000026068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026068]

Predicted Effect

probably benign
Transcript: ENSMUST00000026068
AA Change: Q283K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082
AA Change: Q283K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	49	222	6.9e-35	SMART
EGF	297	332	2.99e-4	SMART
VWA	340	517	1.26e-28	SMART
VWA	528	705	1.55e-37	SMART
EGF	714	747	5e-6	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anln	A	G	9: 22,334,000		probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Capza3	T	A	6: 140,042,060	Y128*	probably null	Het
Ccdc187	T	A	2: 26,282,227		probably benign	Het
Dpp4	T	C	2: 62,379,323	R119G	probably damaging	Het
Espn	T	C	4: 152,134,417	D308G	probably damaging	Het
Gm9857	T	C	3: 108,940,103		probably benign	Het
Hhatl	G	A	9: 121,784,219	A470V	probably benign	Het
Igfals	A	T	17: 24,881,217	E427D	probably benign	Het
Il22ra1	C	T	4: 135,750,713	A365V	possibly damaging	Het
Kctd6	G	C	14: 8,222,806	R216P	probably damaging	Het
Lama1	A	T	17: 67,791,517	M1864L	probably null	Het
Mbd5	T	G	2: 49,272,293	I37S	probably damaging	Het
Nsf	C	A	11: 103,930,806	A5S	probably damaging	Het
Nsun5	A	G	5: 135,370,060	Y26C	probably damaging	Het
Olfr1500	A	G	19: 13,828,429		probably benign	Het
Pitpnm3	C	T	11: 72,074,516	V164I	probably damaging	Het
Plk2	A	G	13: 110,396,103	K117R	probably benign	Het
Ppp1r13b	G	T	12: 111,830,384	N908K	probably damaging	Het
Rapgef4	T	A	2: 72,198,395	N385K	possibly damaging	Het
Rbp3	G	A	14: 33,958,650	V1070I	probably benign	Het
Rhbdd3	C	T	11: 5,105,329	T226I	probably benign	Het
Slc27a3	C	T	3: 90,389,188		probably benign	Het
Slc30a2	G	A	4: 134,346,049	E136K	probably null	Het
Sptlc2	A	C	12: 87,336,151	I393R	probably benign	Het
Tmem260	C	T	14: 48,477,636	T249M	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Uhrf1bp1l	T	G	10: 89,806,709		probably null	Het
Vmn1r80	G	T	7: 12,193,527	C188F	probably benign	Het
Zfp52	A	G	17: 21,561,870	K660R	probably benign	Het

Other mutations in Vwa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01147:Vwa2	APN	19	56901634	missense	probably damaging	0.98
IGL02081:Vwa2	APN	19	56902236	missense	probably benign	0.00
IGL02738:Vwa2	APN	19	56897929	missense	possibly damaging	0.62
H8786:Vwa2	UTSW	19	56909732	missense	possibly damaging	0.90
R0510:Vwa2	UTSW	19	56898068	splice site	probably benign
R1061:Vwa2	UTSW	19	56908994	missense	probably benign	0.35
R1350:Vwa2	UTSW	19	56909126	missense	probably damaging	1.00
R1403:Vwa2	UTSW	19	56881138	missense	unknown
R1403:Vwa2	UTSW	19	56881138	missense	unknown
R1918:Vwa2	UTSW	19	56908934	missense	probably benign	0.07
R2046:Vwa2	UTSW	19	56905578	missense	probably benign	0.08
R3943:Vwa2	UTSW	19	56909315	missense	probably damaging	1.00
R4745:Vwa2	UTSW	19	56906886	missense	probably benign
R5081:Vwa2	UTSW	19	56909320	missense	probably damaging	1.00
R5750:Vwa2	UTSW	19	56909231	missense	probably benign	0.00
R5959:Vwa2	UTSW	19	56881172	missense	possibly damaging	0.96
R6151:Vwa2	UTSW	19	56903465	critical splice acceptor site	probably null
R6361:Vwa2	UTSW	19	56901526	critical splice acceptor site	probably null
R6861:Vwa2	UTSW	19	56901593	missense	probably benign	0.03
R7286:Vwa2	UTSW	19	56909359	missense	probably benign
R7653:Vwa2	UTSW	19	56909335	missense	probably benign	0.00
R7752:Vwa2	UTSW	19	56909240	missense	probably damaging	1.00
X0020:Vwa2	UTSW	19	56909201	missense	probably damaging	1.00
X0066:Vwa2	UTSW	19	56886985	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCAGATGGGAATTTTGCACAC -3'
(R):5'- GCACTCTTTGGCCAAACAC -3'

Sequencing Primer
(F):5'- GGTCTTGAACTTAGAGATCCGCC -3'
(R):5'- TCTTTGGCCAAACACCCACC -3'

Posted On

2015-06-20