Incidental Mutation 'R4278:Vwa2'
ID322785
Institutional Source Beutler Lab
Gene Symbol Vwa2
Ensembl Gene ENSMUSG00000025082
Gene Namevon Willebrand factor A domain containing 2
SynonymsAmaco
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56874249-56912078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56903483 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 283 (Q283K)
Ref Sequence ENSEMBL: ENSMUSP00000026068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
AA Change: Q283K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082
AA Change: Q283K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Ccdc187 T A 2: 26,282,227 probably benign Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Vwa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vwa2 APN 19 56901634 missense probably damaging 0.98
IGL02081:Vwa2 APN 19 56902236 missense probably benign 0.00
IGL02738:Vwa2 APN 19 56897929 missense possibly damaging 0.62
H8786:Vwa2 UTSW 19 56909732 missense possibly damaging 0.90
R0510:Vwa2 UTSW 19 56898068 splice site probably benign
R1061:Vwa2 UTSW 19 56908994 missense probably benign 0.35
R1350:Vwa2 UTSW 19 56909126 missense probably damaging 1.00
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1918:Vwa2 UTSW 19 56908934 missense probably benign 0.07
R2046:Vwa2 UTSW 19 56905578 missense probably benign 0.08
R3943:Vwa2 UTSW 19 56909315 missense probably damaging 1.00
R4745:Vwa2 UTSW 19 56906886 missense probably benign
R5081:Vwa2 UTSW 19 56909320 missense probably damaging 1.00
R5750:Vwa2 UTSW 19 56909231 missense probably benign 0.00
R5959:Vwa2 UTSW 19 56881172 missense possibly damaging 0.96
R6151:Vwa2 UTSW 19 56903465 critical splice acceptor site probably null
R6361:Vwa2 UTSW 19 56901526 critical splice acceptor site probably null
R6861:Vwa2 UTSW 19 56901593 missense probably benign 0.03
R7286:Vwa2 UTSW 19 56909359 missense probably benign
R7653:Vwa2 UTSW 19 56909335 missense probably benign 0.00
R7752:Vwa2 UTSW 19 56909240 missense probably damaging 1.00
X0020:Vwa2 UTSW 19 56909201 missense probably damaging 1.00
X0066:Vwa2 UTSW 19 56886985 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGATGGGAATTTTGCACAC -3'
(R):5'- GCACTCTTTGGCCAAACAC -3'

Sequencing Primer
(F):5'- GGTCTTGAACTTAGAGATCCGCC -3'
(R):5'- TCTTTGGCCAAACACCCACC -3'
Posted On2015-06-20