Incidental Mutation 'R4279:Ccdc73'
ID322788
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Namecoiled-coil domain containing 73
Synonyms2210415I11Rik
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104867805-105017904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104985010 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 364 (N364Y)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111114
AA Change: N364Y

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: N364Y

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
AA Change: N354Y

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106
AA Change: N354Y

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104994591 missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104907627 missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104975616 missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104907568 missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104991840 unclassified probably benign
FR4737:Ccdc73 UTSW 2 104991840 unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104951936 missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104980987 splice site probably benign
R0040:Ccdc73 UTSW 2 104992084 missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104929570 splice site probably benign
R0360:Ccdc73 UTSW 2 104981007 missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104991289 missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104973154 splice site probably benign
R0839:Ccdc73 UTSW 2 104991097 missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104992190 missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104991561 missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104907610 missense possibly damaging 0.72
R1478:Ccdc73 UTSW 2 104914667 missense possibly damaging 0.93
R1695:Ccdc73 UTSW 2 104992105 missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104992292 missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104926935 missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104931045 nonsense probably null
R1987:Ccdc73 UTSW 2 104999159 missense probably damaging 1.00
R2938:Ccdc73 UTSW 2 104975635 nonsense probably null
R3420:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3420:Ccdc73 UTSW 2 104951948 splice site probably null
R3422:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3422:Ccdc73 UTSW 2 104951948 splice site probably null
R3522:Ccdc73 UTSW 2 104991485 missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104991343 missense possibly damaging 0.94
R4791:Ccdc73 UTSW 2 104981105 splice site probably null
R4793:Ccdc73 UTSW 2 105017782 utr 3 prime probably null
R4939:Ccdc73 UTSW 2 104992157 unclassified probably null
R4950:Ccdc73 UTSW 2 104992366 missense probably benign
R5093:Ccdc73 UTSW 2 105017766 utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104992039 missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104989925 missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104930986 missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104992137 missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104907633 missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104992088 missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104991524 nonsense probably null
R7062:Ccdc73 UTSW 2 104951878 missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104973224 missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104999176 missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104951869 missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104994570 missense
R7747:Ccdc73 UTSW 2 104929556 missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104992239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGTTGGCCCTAGGTTTAG -3'
(R):5'- TTATGTTAATCTCCACAGACACACC -3'

Sequencing Primer
(F):5'- CTACCTGTACTGAGTTTGGCAAG -3'
(R):5'- TGGCTGTACTAACTTGTTAAAATCTG -3'
Posted On2015-06-20