Incidental Mutation 'R4279:Slc9a1'
ID322793
Institutional Source Beutler Lab
Gene Symbol Slc9a1
Ensembl Gene ENSMUSG00000028854
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 1
SynonymsApnh, Nhe1, antiporter
MMRRC Submission 041079-MU
Accession Numbers

Genbank: NM_016981; MGI: 102462

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133369706-133423702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133412089 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 206 (F206S)
Ref Sequence ENSEMBL: ENSMUSP00000030669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030669]
Predicted Effect probably benign
Transcript: ENSMUST00000030669
AA Change: F206S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030669
Gene: ENSMUSG00000028854
AA Change: F206S

DomainStartEndE-ValueType
transmembrane domain 15 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 109 509 1.3e-89 PFAM
Pfam:NEXCaM_BD 603 704 1.5e-34 PFAM
low complexity region 757 764 N/A INTRINSIC
low complexity region 803 814 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156079
Meta Mutation Damage Score 0.8989 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Two-thirds of homozygous null mice die before weaning with reduced body weight, ataxia, a relatively mild stomach phenotype, and a postmortem appearance suggestive of death by a convulsive seizure. Homozygotes also display impaired fluid secretion and NaCl absorption in their parotid glands. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6) Spontaneous(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Slc9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc9a1 APN 4 133370548 missense probably benign 0.03
IGL00949:Slc9a1 APN 4 133416451 missense probably benign 0.03
IGL00952:Slc9a1 APN 4 133416382 missense probably damaging 0.99
IGL01023:Slc9a1 APN 4 133422143 missense probably benign 0.04
IGL01151:Slc9a1 APN 4 133411989 missense probably damaging 1.00
IGL01796:Slc9a1 APN 4 133420093 splice site probably benign
IGL01896:Slc9a1 APN 4 133418059 missense probably damaging 1.00
IGL02621:Slc9a1 APN 4 133370568 missense probably benign
F6893:Slc9a1 UTSW 4 133422146 missense probably benign 0.06
R0123:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0134:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0225:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0658:Slc9a1 UTSW 4 133420499 splice site probably benign
R0759:Slc9a1 UTSW 4 133416403 missense probably damaging 1.00
R0781:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1110:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1316:Slc9a1 UTSW 4 133422247 missense possibly damaging 0.95
R1637:Slc9a1 UTSW 4 133422223 missense probably benign
R1680:Slc9a1 UTSW 4 133418080 missense probably damaging 1.00
R2050:Slc9a1 UTSW 4 133416334 missense probably benign 0.02
R4960:Slc9a1 UTSW 4 133370656 missense probably damaging 1.00
R5381:Slc9a1 UTSW 4 133422071 missense probably damaging 0.96
R5590:Slc9a1 UTSW 4 133421563 missense probably damaging 0.99
R5638:Slc9a1 UTSW 4 133412260 missense probably damaging 1.00
R5935:Slc9a1 UTSW 4 133419865 intron probably benign
R6334:Slc9a1 UTSW 4 133422208 missense possibly damaging 0.64
R6402:Slc9a1 UTSW 4 133370651 missense probably benign 0.37
R7553:Slc9a1 UTSW 4 133412269 missense probably damaging 1.00
R7772:Slc9a1 UTSW 4 133411965 missense probably damaging 1.00
R7843:Slc9a1 UTSW 4 133370442 start gained probably benign
R7926:Slc9a1 UTSW 4 133370442 start gained probably benign
X0018:Slc9a1 UTSW 4 133418071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGATCCCCACCATCTCAAG -3'
(R):5'- CCCGAAGACAAGGATGTGTAGC -3'

Sequencing Primer
(F):5'- ATCTCAAGCATCGTCCCGGAG -3'
(R):5'- ACAAGGATGTGTAGCAGTTCG -3'
Posted On2015-06-20