Incidental Mutation 'R4279:Gimap4'
ID322795
Institutional Source Beutler Lab
Gene Symbol Gimap4
Ensembl Gene ENSMUSG00000054435
Gene NameGTPase, IMAP family member 4
SynonymsIan1, E430007K16Rik
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48684549-48692060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48690577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 89 (I89V)
Ref Sequence ENSEMBL: ENSMUSP00000087524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067506] [ENSMUST00000090070] [ENSMUST00000118802] [ENSMUST00000119575] [ENSMUST00000121957] [ENSMUST00000156770]
Predicted Effect probably benign
Transcript: ENSMUST00000067506
AA Change: I89V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068398
Gene: ENSMUSG00000054435
AA Change: I89V

DomainStartEndE-ValueType
Pfam:AIG1 31 218 4.2e-72 PFAM
Pfam:MMR_HSR1 32 186 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090070
AA Change: I89V

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087524
Gene: ENSMUSG00000054435
AA Change: I89V

DomainStartEndE-ValueType
Pfam:AIG1 31 242 1.5e-80 PFAM
Pfam:MMR_HSR1 32 170 1.6e-10 PFAM
low complexity region 265 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118802
SMART Domains Protein: ENSMUSP00000112530
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 53 1.6e-7 PFAM
Pfam:AIG1 48 114 6.4e-17 PFAM
low complexity region 137 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119575
SMART Domains Protein: ENSMUSP00000113989
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
SCOP:d1zin_1 31 50 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121957
SMART Domains Protein: ENSMUSP00000113016
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 55 4.3e-8 PFAM
Pfam:AIG1 48 89 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156770
SMART Domains Protein: ENSMUSP00000122070
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 69 6.7e-17 PFAM
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show no detectable alterations in T-cell development, selection and activation; however, mutant T cells exhibit a delay in the execution of programmed cell death induced by intrinsic stimuli downstream of caspase-3 activation and phosphatidylserine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Gimap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gimap4 APN 6 48690938 missense probably damaging 1.00
IGL01917:Gimap4 APN 6 48690920 missense probably benign 0.02
IGL02302:Gimap4 APN 6 48690413 missense probably damaging 1.00
IGL02679:Gimap4 APN 6 48690495 nonsense probably null
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1584:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R2079:Gimap4 UTSW 6 48690947 missense possibly damaging 0.46
R2118:Gimap4 UTSW 6 48690971 missense probably benign 0.24
R2566:Gimap4 UTSW 6 48690865 missense probably damaging 1.00
R5592:Gimap4 UTSW 6 48691158 missense probably damaging 0.99
R5597:Gimap4 UTSW 6 48690764 missense probably damaging 1.00
R6162:Gimap4 UTSW 6 48690721 missense probably damaging 0.97
R6354:Gimap4 UTSW 6 48686880 missense possibly damaging 0.53
R6658:Gimap4 UTSW 6 48691404 missense possibly damaging 0.65
X0050:Gimap4 UTSW 6 48690800 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGAATTCCCCAACTGAGAATTGTC -3'
(R):5'- CTAAGTCATCCTTCCTGGTGAGC -3'

Sequencing Primer
(F):5'- CCCAACTGAGAATTGTCTTACTTGG -3'
(R):5'- TCCTTCCTGGTGAGCAAGAGAATC -3'
Posted On2015-06-20