Incidental Mutation 'R4279:Mogs'
ID322796
Institutional Source Beutler Lab
Gene Symbol Mogs
Ensembl Gene ENSMUSG00000030036
Gene Namemannosyl-oligosaccharide glucosidase
SynonymsGcs1, 1810017N02Rik
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83115496-83118898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83116067 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 132 (L132P)
Ref Sequence ENSEMBL: ENSMUSP00000032114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113936] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000032114
AA Change: L132P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036
AA Change: L132P

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123394
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145403
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Meta Mutation Damage Score 0.9123 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Mogs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mogs APN 6 83118577 missense probably damaging 1.00
IGL02314:Mogs APN 6 83118055 missense probably benign 0.00
IGL02673:Mogs APN 6 83118218 missense probably damaging 1.00
IGL02862:Mogs APN 6 83115890 missense probably damaging 1.00
IGL02984:Mogs UTSW 6 83117315 missense probably benign 0.00
R1547:Mogs UTSW 6 83116025 missense possibly damaging 0.93
R1765:Mogs UTSW 6 83116803 missense probably benign 0.00
R2013:Mogs UTSW 6 83117650 nonsense probably null
R2015:Mogs UTSW 6 83117650 nonsense probably null
R3735:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R3736:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R4585:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R4586:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R5783:Mogs UTSW 6 83118671 missense probably damaging 1.00
R5825:Mogs UTSW 6 83118212 missense possibly damaging 0.72
R6012:Mogs UTSW 6 83117382 missense probably damaging 1.00
R6753:Mogs UTSW 6 83115882 missense probably damaging 1.00
R7157:Mogs UTSW 6 83118507 missense probably benign 0.01
R7381:Mogs UTSW 6 83115632 missense unknown
R7485:Mogs UTSW 6 83116207 missense probably damaging 1.00
R7575:Mogs UTSW 6 83115835 missense probably damaging 1.00
R7659:Mogs UTSW 6 83116825 critical splice donor site probably null
Z1176:Mogs UTSW 6 83116213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGTCTATTTCGGCATGAAG -3'
(R):5'- TGTGCAAAGACGATCCTGATG -3'

Sequencing Primer
(F):5'- ATTTCGGCATGAAGACTCGC -3'
(R):5'- AAGACGATCCTGATGCCCTG -3'
Posted On2015-06-20