Incidental Mutation 'R4279:Fxyd5'
ID322799
Institutional Source Beutler Lab
Gene Symbol Fxyd5
Ensembl Gene ENSMUSG00000009687
Gene NameFXYD domain-containing ion transport regulator 5
SynonymsEF-8, Oit2
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31032722-31042481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31035386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 139 (D139Y)
Ref Sequence ENSEMBL: ENSMUSP00000125173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162087] [ENSMUST00000162116] [ENSMUST00000162733] [ENSMUST00000202395]
Predicted Effect probably null
Transcript: ENSMUST00000009831
AA Change: D139Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687
AA Change: D139Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159753
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159924
AA Change: D138Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687
AA Change: D138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160006
Predicted Effect probably benign
Transcript: ENSMUST00000160689
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161684
AA Change: D138Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687
AA Change: D138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161805
AA Change: D138Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687
AA Change: D138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162087
AA Change: D138Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687
AA Change: D138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162116
AA Change: D138Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687
AA Change: D138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162250
AA Change: D76Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124129
Gene: ENSMUSG00000009687
AA Change: D76Y

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 69 113 7.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162733
AA Change: D139Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687
AA Change: D139Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184636
Predicted Effect probably benign
Transcript: ENSMUST00000202395
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205301
Meta Mutation Damage Score 0.9275 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Fxyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Fxyd5 APN 7 31035218 missense probably damaging 0.96
IGL01913:Fxyd5 APN 7 31035212 missense probably damaging 0.99
IGL02071:Fxyd5 APN 7 31040188 missense possibly damaging 0.46
IGL02800:Fxyd5 APN 7 31032979 missense possibly damaging 0.95
R1812:Fxyd5 UTSW 7 31037930 critical splice acceptor site probably null
R2362:Fxyd5 UTSW 7 31036471 missense probably benign 0.00
R3690:Fxyd5 UTSW 7 31036439 missense possibly damaging 0.95
R4786:Fxyd5 UTSW 7 31041482 unclassified probably benign
R6410:Fxyd5 UTSW 7 31035406 missense probably damaging 1.00
R6465:Fxyd5 UTSW 7 31037880 missense probably damaging 0.96
R7257:Fxyd5 UTSW 7 31035151 missense unknown
R7309:Fxyd5 UTSW 7 31035404 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTCAGTCACCATGCAGC -3'
(R):5'- TGTCACATTGAGGACTTCCAC -3'

Sequencing Primer
(F):5'- ATGCCCGACTCTCACTAGTG -3'
(R):5'- GAGGACTTCCACTTCTGTTCTGAG -3'
Posted On2015-06-20