Incidental Mutation 'R4279:Olfr575'
ID322801
Institutional Source Beutler Lab
Gene Symbol Olfr575
Ensembl Gene ENSMUSG00000066269
Gene Nameolfactory receptor 575
SynonymsGA_x6K02T2PBJ9-5666843-5665908, MOR8-1
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102952270-102958775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102955085 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 179 (Q179L)
Ref Sequence ENSEMBL: ENSMUSP00000081873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084812] [ENSMUST00000209778] [ENSMUST00000213477] [ENSMUST00000216420]
Predicted Effect probably benign
Transcript: ENSMUST00000084812
AA Change: Q179L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081873
Gene: ENSMUSG00000066269
AA Change: Q179L

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 4.6e-112 PFAM
Pfam:7TM_GPCR_Srsx 44 312 2.6e-10 PFAM
Pfam:7tm_1 50 300 6.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209778
AA Change: Q172L
Predicted Effect probably benign
Transcript: ENSMUST00000213477
AA Change: Q172L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216420
AA Change: Q172L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Olfr575
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr575 APN 7 102955104 missense probably benign 0.01
IGL02583:Olfr575 APN 7 102954711 missense possibly damaging 0.96
R0003:Olfr575 UTSW 7 102954978 missense probably benign
R1553:Olfr575 UTSW 7 102955218 missense possibly damaging 0.87
R1641:Olfr575 UTSW 7 102954968 missense probably benign 0.07
R1993:Olfr575 UTSW 7 102954746 missense probably damaging 1.00
R4905:Olfr575 UTSW 7 102955514 missense probably damaging 0.96
R5992:Olfr575 UTSW 7 102955009 missense probably benign 0.25
R6122:Olfr575 UTSW 7 102954804 missense probably damaging 0.99
R6122:Olfr575 UTSW 7 102955530 missense probably benign
R6391:Olfr575 UTSW 7 102955415 missense possibly damaging 0.66
R6685:Olfr575 UTSW 7 102955681 splice site probably null
R7109:Olfr575 UTSW 7 102955253 missense probably damaging 1.00
R7117:Olfr575 UTSW 7 102954978 missense probably benign
R7901:Olfr575 UTSW 7 102955680 critical splice acceptor site probably null
R7984:Olfr575 UTSW 7 102955680 critical splice acceptor site probably null
Z1177:Olfr575 UTSW 7 102954976 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGTATTGAGGGCCTTGAG -3'
(R):5'- ATGGCTTCACTGACATGGAG -3'

Sequencing Primer
(F):5'- TATGGGATCCAATGCCCATC -3'
(R):5'- GACATGGAGTCCTCAGTGCTTC -3'
Posted On2015-06-20