Incidental Mutation 'R4279:Zfp365'
ID322809
Institutional Source Beutler Lab
Gene Symbol Zfp365
Ensembl Gene ENSMUSG00000037855
Gene Namezinc finger protein 365
SynonymsSu48, DBZ
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location67886103-67912662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67897601 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 254 (F254I)
Ref Sequence ENSEMBL: ENSMUSP00000067197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064656]
Predicted Effect probably benign
Transcript: ENSMUST00000064656
AA Change: F254I

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067197
Gene: ENSMUSG00000037855
AA Change: F254I

DomainStartEndE-ValueType
ZnF_C2H2 26 51 4.05e-1 SMART
coiled coil region 170 298 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138543
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms which have different expression patterns and functions. Mutation in this gene is associated with uric acid nephrolithiasis (UAN). Alternatively spliced variants, encoding distinct proteins, have been identified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal cortical basket cells in the somatosensory cortices, delayed myelination in the corpus callosum during the early postnatal period, and an increase in immature oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Other mutations in Zfp365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp365 APN 10 67909354 missense probably damaging 1.00
IGL03257:Zfp365 APN 10 67889038 missense possibly damaging 0.76
ANU18:Zfp365 UTSW 10 67909354 missense probably damaging 1.00
R0482:Zfp365 UTSW 10 67897606 missense probably damaging 1.00
R1800:Zfp365 UTSW 10 67888942 missense probably damaging 0.98
R1986:Zfp365 UTSW 10 67909856 missense probably damaging 1.00
R4475:Zfp365 UTSW 10 67888920 missense possibly damaging 0.87
R4951:Zfp365 UTSW 10 67889991 critical splice acceptor site probably null
R5599:Zfp365 UTSW 10 67909367 missense probably damaging 1.00
R5682:Zfp365 UTSW 10 67909807 missense probably damaging 1.00
R5697:Zfp365 UTSW 10 67909640 missense probably benign 0.01
R5837:Zfp365 UTSW 10 67889040 missense probably damaging 1.00
R5982:Zfp365 UTSW 10 67897607 missense probably damaging 1.00
R6974:Zfp365 UTSW 10 67909764 missense probably damaging 1.00
R7043:Zfp365 UTSW 10 67909826 missense probably damaging 1.00
R7861:Zfp365 UTSW 10 67909919 missense probably damaging 0.98
R7944:Zfp365 UTSW 10 67909919 missense probably damaging 0.98
Z1176:Zfp365 UTSW 10 67909260 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGGACTCACCATATGCTCACTAG -3'
(R):5'- ACCTTGTACCTAGTTCCAATGCTG -3'

Sequencing Primer
(F):5'- ATATGCTCACTAGTGTCACAGC -3'
(R):5'- TGCTGTTAACTCCTGACAGAAC -3'
Posted On2015-06-20