Mutagenetix > Incidental Mutation

Incidental Mutation 'R4279:Gcnt2'

322812

Institutional Source

Beutler Lab

Gene Symbol

Gcnt2

Ensembl Gene

ENSMUSG00000021360

Gene Name

glucosaminyl (N-acetyl) transferase 2, I-branching enzyme

Synonyms

IGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik

MMRRC Submission

041079-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R4279 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40859754-40960892 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40888190 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 275 (V275A)

Ref Sequence

ENSEMBL: ENSMUSP00000070942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069958] [ENSMUST00000110191]

AlphaFold

P97402

Predicted Effect

probably benign
Transcript: ENSMUST00000069958
AA Change: V275A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360
AA Change: V275A

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
Pfam:Branch	95	357	8.4e-60	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110191

SMART Domains

Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
Pfam:Branch	95	357	5.2e-61	PFAM
low complexity region	377	386	N/A	INTRINSIC

Meta Mutation Damage Score

0.2090

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	T	A	15: 96,371,756	L1250Q	probably damaging	Het
Ccdc73	A	T	2: 104,985,010	N364Y	possibly damaging	Het
Ccl25	T	A	8: 4,349,829	L56Q	probably damaging	Het
Ctnnd2	C	A	15: 30,905,820	A871E	probably damaging	Het
Cyp2b23	C	T	7: 26,666,027	S461N	possibly damaging	Het
Dgat2	C	A	7: 99,164,705	G120V	probably damaging	Het
Dsp	A	T	13: 38,185,231	I768F	probably damaging	Het
Dzank1	T	C	2: 144,491,845	E356G	probably benign	Het
Fam120a	A	T	13: 48,889,258	V889D	probably benign	Het
Fxyd5	C	A	7: 31,035,386	D139Y	probably null	Het
Gimap4	A	G	6: 48,690,577	I89V	probably benign	Het
Gm6578	G	A	6: 12,100,188		noncoding transcript	Het
Jmjd8	A	G	17: 25,829,813		probably benign	Het
Jmy	G	C	13: 93,498,882	P142R	probably damaging	Het
Jmy	C	A	13: 93,499,273	D12Y	probably damaging	Het
Kif13b	G	T	14: 64,779,356	A1324S	probably damaging	Het
Klhl31	T	C	9: 77,655,839	S629P	unknown	Het
Lpar1	A	G	4: 58,487,115	V52A	possibly damaging	Het
Lrp5	A	G	19: 3,591,778	S1395P	possibly damaging	Het
Mogs	T	C	6: 83,116,067	L132P	probably damaging	Het
Ncam1	C	A	9: 49,506,959		probably benign	Het
Ndufs8	A	T	19: 3,911,014	F88I	probably damaging	Het
Nos2	T	A	11: 78,929,776	L69Q	probably benign	Het
Olfr575	T	A	7: 102,955,085	Q179L	probably benign	Het
Pls3	A	T	X: 75,802,532	I192N	probably benign	Het
Psmd6	T	C	14: 14,112,297	N388S	possibly damaging	Het
Rrbp1	T	C	2: 143,963,108	T1046A	probably benign	Het
Scn11a	T	C	9: 119,754,362	E1729G	probably benign	Het
Slc6a3	A	G	13: 73,544,834	D191G	possibly damaging	Het
Slc9a1	T	C	4: 133,412,089	F206S	probably benign	Het
Tmc5	A	G	7: 118,674,663	*968W	probably null	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc13a	T	C	8: 71,666,667	K9R	probably damaging	Het
Vegfa	A	G	17: 46,031,466	V142A	probably benign	Het
Vmn1r119	T	A	7: 21,011,861	M199L	probably benign	Het
Vnn1	A	T	10: 23,898,512	D151V	possibly damaging	Het
Zfp365	A	T	10: 67,897,601	F254I	probably benign	Het

Other mutations in Gcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01523:Gcnt2	APN	13	40887863	missense	probably benign	0.06
IGL01693:Gcnt2	APN	13	40888073	missense	probably benign
IGL02506:Gcnt2	APN	13	40887380	missense	probably benign	0.02
IGL03184:Gcnt2	APN	13	40888184	missense	probably benign	0.01
BB001:Gcnt2	UTSW	13	40918564	nonsense	probably null
BB011:Gcnt2	UTSW	13	40918564	nonsense	probably null
PIT4472001:Gcnt2	UTSW	13	40917937	missense	probably benign	0.39
R0358:Gcnt2	UTSW	13	40860853	missense	probably damaging	0.99
R0734:Gcnt2	UTSW	13	40860521	missense	probably benign	0.00
R1863:Gcnt2	UTSW	13	40861101	missense	possibly damaging	0.95
R3103:Gcnt2	UTSW	13	40918606	missense	probably benign	0.00
R3156:Gcnt2	UTSW	13	40861178	missense	probably benign	0.36
R3893:Gcnt2	UTSW	13	40860446	missense	probably benign	0.14
R4134:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4135:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4422:Gcnt2	UTSW	13	40860525	nonsense	probably null
R4599:Gcnt2	UTSW	13	40887490	missense	probably benign
R4618:Gcnt2	UTSW	13	40958194	nonsense	probably null
R4908:Gcnt2	UTSW	13	40860734	missense	probably damaging	1.00
R5123:Gcnt2	UTSW	13	40918355	missense	probably damaging	0.99
R5291:Gcnt2	UTSW	13	40918792	missense	probably damaging	1.00
R5437:Gcnt2	UTSW	13	40861176	missense	probably damaging	1.00
R5463:Gcnt2	UTSW	13	40918174	missense	possibly damaging	0.80
R5471:Gcnt2	UTSW	13	40860719	missense	probably damaging	1.00
R5472:Gcnt2	UTSW	13	40953579	missense	probably benign	0.30
R5493:Gcnt2	UTSW	13	40953600	missense	possibly damaging	0.70
R5586:Gcnt2	UTSW	13	40860953	missense	probably damaging	1.00
R5695:Gcnt2	UTSW	13	40918199	missense	probably benign	0.03
R6244:Gcnt2	UTSW	13	40861241	missense	probably damaging	1.00
R6293:Gcnt2	UTSW	13	40918697	missense	probably damaging	1.00
R7036:Gcnt2	UTSW	13	40887556	frame shift	probably null
R7077:Gcnt2	UTSW	13	40860420	missense	probably benign
R7432:Gcnt2	UTSW	13	40887212	intron	probably benign
R7474:Gcnt2	UTSW	13	40958257	missense	probably damaging	1.00
R7508:Gcnt2	UTSW	13	40887681	missense	probably benign	0.02
R7599:Gcnt2	UTSW	13	40860867	nonsense	probably null
R7678:Gcnt2	UTSW	13	40953719	missense	probably benign	0.01
R7806:Gcnt2	UTSW	13	40918241	missense	probably damaging	1.00
R7808:Gcnt2	UTSW	13	40860862	missense	possibly damaging	0.81
R7909:Gcnt2	UTSW	13	40860450	missense	probably benign	0.00
R7924:Gcnt2	UTSW	13	40918564	nonsense	probably null
R8110:Gcnt2	UTSW	13	40917722	start gained	probably benign
R8287:Gcnt2	UTSW	13	40860632	missense	probably damaging	1.00
R8782:Gcnt2	UTSW	13	40918753	missense	probably damaging	0.98
R8956:Gcnt2	UTSW	13	40887728	missense	probably benign	0.30
R9225:Gcnt2	UTSW	13	40860860	missense	probably damaging	1.00
R9357:Gcnt2	UTSW	13	40888256	missense	possibly damaging	0.92
Z1088:Gcnt2	UTSW	13	40918639	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTACCTGAAAGGGCTTAAGG -3'
(R):5'- GTTGAACCCTGAAATGTGTCACC -3'

Sequencing Primer
(F):5'- GAAGAACCTCACTCCCGGG -3'
(R):5'- AAATGTGTCACCTGTGGACC -3'

Posted On

2015-06-20