Incidental Mutation 'R4279:Fam120a'
ID322813
Institutional Source Beutler Lab
Gene Symbol Fam120a
Ensembl Gene ENSMUSG00000038014
Gene Namefamily with sequence similarity 120, member A
Synonyms
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4279 (G1)
Quality Score218
Status Validated
Chromosome13
Chromosomal Location48879219-48968017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48889258 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 889 (V889D)
Ref Sequence ENSEMBL: ENSMUSP00000053877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060805]
Predicted Effect probably benign
Transcript: ENSMUST00000060805
AA Change: V889D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053877
Gene: ENSMUSG00000038014
AA Change: V889D

DomainStartEndE-ValueType
Blast:XPGN 1 112 1e-15 BLAST
low complexity region 348 361 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 881 897 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
low complexity region 972 986 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1026 1044 N/A INTRINSIC
Meta Mutation Damage Score 0.1377 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Fam120a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Fam120a APN 13 48889133 missense probably benign
IGL01087:Fam120a APN 13 48902073 missense probably damaging 1.00
IGL02052:Fam120a APN 13 48933945 splice site probably benign
IGL02409:Fam120a APN 13 48967359 missense probably benign 0.05
IGL03172:Fam120a APN 13 48910336 missense probably damaging 1.00
Green_flash UTSW 13 48891964 missense probably damaging 1.00
Sunset UTSW 13 48910250 splice site probably null
upended UTSW 13 48897667 missense probably damaging 1.00
R0036:Fam120a UTSW 13 48889264 splice site probably benign
R0042:Fam120a UTSW 13 48934014 missense probably damaging 1.00
R0689:Fam120a UTSW 13 48967638 missense probably damaging 1.00
R0741:Fam120a UTSW 13 48891940 missense possibly damaging 0.91
R0899:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0900:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0987:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0989:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0990:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1080:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1121:Fam120a UTSW 13 48910437 splice site probably null
R1265:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1423:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1611:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1755:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R2041:Fam120a UTSW 13 48897767 missense probably benign 0.01
R2433:Fam120a UTSW 13 48933968 missense probably damaging 1.00
R2496:Fam120a UTSW 13 48967593 missense probably damaging 0.99
R3122:Fam120a UTSW 13 48892086 missense possibly damaging 0.45
R4758:Fam120a UTSW 13 48880857 missense probably benign 0.02
R4924:Fam120a UTSW 13 48902096 missense probably benign 0.04
R5000:Fam120a UTSW 13 48897667 missense probably damaging 1.00
R5039:Fam120a UTSW 13 48910250 splice site probably null
R5194:Fam120a UTSW 13 48880935 missense probably benign
R5772:Fam120a UTSW 13 48880933 missense probably benign
R6765:Fam120a UTSW 13 48891964 missense probably damaging 1.00
R6820:Fam120a UTSW 13 48880992 missense possibly damaging 0.51
R6833:Fam120a UTSW 13 48934041 missense probably damaging 1.00
R6895:Fam120a UTSW 13 48892021 missense probably benign 0.07
R6946:Fam120a UTSW 13 48881020 missense possibly damaging 0.83
R7032:Fam120a UTSW 13 48949113 missense probably benign 0.34
R7081:Fam120a UTSW 13 48910325 missense probably damaging 0.98
R7289:Fam120a UTSW 13 48892006 missense probably damaging 1.00
R7503:Fam120a UTSW 13 48949247 missense probably benign 0.00
X0003:Fam120a UTSW 13 48949138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTCTAGATGCTGGAGC -3'
(R):5'- GCCCTATTGAATGACTGCTAAGGG -3'

Sequencing Primer
(F):5'- GGTAATAATTACCGCCCTGG -3'
(R):5'- TATTGAATGACTGCTAAGGGAGGCTG -3'
Posted On2015-06-20