Incidental Mutation 'R4279:Slc6a3'
ID322814
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73544834 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022100
AA Change: D191G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: D191G

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Meta Mutation Damage Score 0.2054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGGGGCATGCTGCTGATG -3'
(R):5'- CAAGGATAGGGACTTGTTCAGC -3'

Sequencing Primer
(F):5'- GCTGCTGATGCTGGCTCTAC -3'
(R):5'- TAGGGACTTGTTCAGCACAGC -3'
Posted On2015-06-20