Incidental Mutation 'R4279:Psmd6'
ID322817
Institutional Source Beutler Lab
Gene Symbol Psmd6
Ensembl Gene ENSMUSG00000021737
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14112174-14120984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14112297 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 388 (N388S)
Ref Sequence ENSEMBL: ENSMUSP00000022256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022256] [ENSMUST00000022257] [ENSMUST00000224955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022256
AA Change: N388S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022256
Gene: ENSMUSG00000021737
AA Change: N388S

DomainStartEndE-ValueType
Pfam:RPN7 66 239 5e-65 PFAM
PINT 290 373 9.59e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022257
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224076
Predicted Effect probably benign
Transcript: ENSMUST00000224955
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Psmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Psmd6 APN 14 14114237 missense probably damaging 1.00
IGL01937:Psmd6 APN 14 14116169 missense probably benign 0.00
IGL03240:Psmd6 APN 14 14112393 unclassified probably benign
IGL03284:Psmd6 APN 14 14112546 missense probably benign 0.00
R1479:Psmd6 UTSW 14 14116819 intron probably benign
R1627:Psmd6 UTSW 14 14112539 missense probably damaging 1.00
R1942:Psmd6 UTSW 14 14116442 missense probably damaging 1.00
R4151:Psmd6 UTSW 14 14120157 missense probably benign 0.02
R4776:Psmd6 UTSW 14 14120932 unclassified probably benign
R4799:Psmd6 UTSW 14 14120126 missense probably benign
R4956:Psmd6 UTSW 14 14116166 missense probably benign 0.16
R5599:Psmd6 UTSW 14 14120144 missense probably benign 0.01
R5828:Psmd6 UTSW 14 14119990 missense probably benign 0.16
R5884:Psmd6 UTSW 14 14116526 missense probably damaging 1.00
R6362:Psmd6 UTSW 14 14116949 missense probably benign 0.07
R7208:Psmd6 UTSW 14 14112225 utr 3 prime probably null
R7590:Psmd6 UTSW 14 14119882 frame shift probably null
R7677:Psmd6 UTSW 14 14120837 missense probably benign 0.19
R7773:Psmd6 UTSW 14 14119882 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCGGCATTAGTGGACC -3'
(R):5'- CCAACAGGTAACCTTATTATCTTCC -3'

Sequencing Primer
(F):5'- GGCATTAGTGGACCCAGTAC -3'
(R):5'- AGTTTTAAGTGCCTGAGTGTACAAG -3'
Posted On2015-06-20