Incidental Mutation 'R4279:Lrp5'
ID322823
Institutional Source Beutler Lab
Gene Symbol Lrp5
Ensembl Gene ENSMUSG00000024913
Gene Namelow density lipoprotein receptor-related protein 5
SynonymsLR3, LRP7
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3584828-3686564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3591778 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1395 (S1395P)
Ref Sequence ENSEMBL: ENSMUSP00000025856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000177294] [ENSMUST00000177330]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025856
AA Change: S1395P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: S1395P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177294
SMART Domains Protein: ENSMUSP00000134771
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
LY 1 26 1.88e1 SMART
LY 27 70 3.81e-11 SMART
LY 71 112 3.54e-6 SMART
LY 113 152 1.33e-1 SMART
EGF 179 216 1.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177330
SMART Domains Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
Meta Mutation Damage Score 0.1657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Lrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrp5 APN 19 3649404 missense probably benign
IGL00902:Lrp5 APN 19 3600774 missense probably damaging 1.00
IGL02032:Lrp5 APN 19 3615886 splice site probably benign
IGL02331:Lrp5 APN 19 3591816 missense possibly damaging 0.64
IGL02401:Lrp5 APN 19 3593585 missense probably damaging 1.00
IGL02471:Lrp5 APN 19 3602408 missense probably benign 0.31
IGL02572:Lrp5 APN 19 3614283 missense probably benign 0.17
IGL02637:Lrp5 APN 19 3630269 missense probably benign 0.03
IGL02696:Lrp5 APN 19 3602253 missense probably benign
IGL02742:Lrp5 APN 19 3604022 missense probably damaging 0.99
IGL02804:Lrp5 APN 19 3600777 missense possibly damaging 0.63
IGL03089:Lrp5 APN 19 3620314 splice site probably null
IGL03243:Lrp5 APN 19 3630159 missense probably benign 0.12
lucent UTSW 19 3686353 critical splice donor site probably null
r18 UTSW 19 small insertion
PIT4494001:Lrp5 UTSW 19 3610091 missense probably damaging 1.00
R0219:Lrp5 UTSW 19 3597349 missense probably damaging 1.00
R0526:Lrp5 UTSW 19 3628295 missense probably damaging 1.00
R0597:Lrp5 UTSW 19 3600777 missense possibly damaging 0.63
R0883:Lrp5 UTSW 19 3605308 missense probably damaging 1.00
R1086:Lrp5 UTSW 19 3649476 missense probably benign 0.28
R1417:Lrp5 UTSW 19 3586425 missense probably benign 0.04
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1533:Lrp5 UTSW 19 3614234 missense probably benign 0.17
R1538:Lrp5 UTSW 19 3647585 missense possibly damaging 0.70
R1856:Lrp5 UTSW 19 3597346 missense probably benign 0.18
R1930:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1931:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1932:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1951:Lrp5 UTSW 19 3620298 missense possibly damaging 0.89
R2016:Lrp5 UTSW 19 3610056 missense probably benign 0.04
R2131:Lrp5 UTSW 19 3622708 missense possibly damaging 0.87
R2153:Lrp5 UTSW 19 3614339 missense probably benign 0.22
R2403:Lrp5 UTSW 19 3597430 missense probably damaging 1.00
R3158:Lrp5 UTSW 19 3615849 missense probably damaging 0.97
R3771:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3772:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3773:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3825:Lrp5 UTSW 19 3605290 nonsense probably null
R3887:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3888:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3893:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3917:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R4714:Lrp5 UTSW 19 3659454 missense probably damaging 1.00
R4825:Lrp5 UTSW 19 3614292 missense probably damaging 1.00
R5102:Lrp5 UTSW 19 3659304 missense probably damaging 0.96
R5138:Lrp5 UTSW 19 3628319 missense probably benign 0.03
R5497:Lrp5 UTSW 19 3602319 missense probably damaging 1.00
R5632:Lrp5 UTSW 19 3622512 missense probably benign
R5887:Lrp5 UTSW 19 3604094 missense probably benign 0.01
R5950:Lrp5 UTSW 19 3602333 missense probably benign 0.17
R5987:Lrp5 UTSW 19 3628299 missense probably damaging 1.00
R6080:Lrp5 UTSW 19 3628316 missense probably benign 0.32
R6181:Lrp5 UTSW 19 3628427 missense probably damaging 1.00
R6236:Lrp5 UTSW 19 3630483 splice site probably null
R6332:Lrp5 UTSW 19 3659355 missense probably damaging 1.00
R6511:Lrp5 UTSW 19 3652296 missense probably damaging 1.00
R6641:Lrp5 UTSW 19 3652287 missense probably damaging 1.00
R6791:Lrp5 UTSW 19 3600753 missense probably damaging 1.00
R6865:Lrp5 UTSW 19 3620013 critical splice donor site probably null
R6906:Lrp5 UTSW 19 3622638 missense probably damaging 1.00
R6922:Lrp5 UTSW 19 3605301 missense probably damaging 1.00
R7091:Lrp5 UTSW 19 3630184 missense probably damaging 1.00
R7303:Lrp5 UTSW 19 3591774 missense probably damaging 0.99
R7368:Lrp5 UTSW 19 3620085 missense possibly damaging 0.95
R7381:Lrp5 UTSW 19 3593588 missense probably benign 0.20
R7385:Lrp5 UTSW 19 3612197 critical splice donor site probably null
R7392:Lrp5 UTSW 19 3610199 missense probably damaging 1.00
R7448:Lrp5 UTSW 19 3649439 missense probably benign 0.01
R7585:Lrp5 UTSW 19 3604094 missense possibly damaging 0.88
R7662:Lrp5 UTSW 19 3686353 critical splice donor site probably null
R8056:Lrp5 UTSW 19 3597337 missense probably damaging 0.98
Z1177:Lrp5 UTSW 19 3628345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGCTTCAGGCTCCTCACC -3'
(R):5'- GAGTGAGCCAAACCCATGTC -3'

Sequencing Primer
(F):5'- TCCTCACCTGGGAAGGGAC -3'
(R):5'- GCTACTCCTGCAGCTGCTG -3'
Posted On2015-06-20