Incidental Mutation 'R4281:Rars'
ID322907
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
Synonyms
MMRRC Submission 041649-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4281 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35821224 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 275 (E275G)
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect probably damaging
Transcript: ENSMUST00000018992
AA Change: E275G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848
AA Change: E275G

DomainStartEndE-ValueType
Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166122
Meta Mutation Damage Score 0.7030 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
B9d2 A G 7: 25,681,426 T14A possibly damaging Het
Cavin3 A C 7: 105,481,774 probably null Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Evc2 T C 5: 37,338,594 V16A probably benign Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Gimap8 A C 6: 48,658,820 R506S probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Gtf2a1l A G 17: 88,711,637 N383S possibly damaging Het
Hepacam2 G A 6: 3,475,938 T329I probably damaging Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Lrrc6 A T 15: 66,380,529 H429Q probably benign Het
Mark4 T C 7: 19,433,446 K456R probably benign Het
Nox4 A G 7: 87,297,524 I143V possibly damaging Het
Olfr530 A G 7: 140,373,472 I46T probably benign Het
Olfr746 T C 14: 50,653,572 C112R probably benign Het
Pcdh18 A G 3: 49,756,533 L111P possibly damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Pnpla6 T C 8: 3,521,513 L148P probably damaging Het
Prkdc A G 16: 15,806,099 probably null Het
Rasa3 A G 8: 13,588,946 V287A probably benign Het
Rimbp2 C T 5: 128,788,340 R641Q possibly damaging Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tmem132a C G 19: 10,861,726 E451Q possibly damaging Het
Tmem229b-ps A G 10: 53,475,378 noncoding transcript Het
Trim33 T A 3: 103,329,086 V504D probably damaging Het
Usp47 A T 7: 112,109,993 E1315D probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp612 A G 8: 110,090,059 I594V probably damaging Het
Zfp692 T C 11: 58,314,265 F447L probably damaging Het
Zranb3 A C 1: 127,963,877 S787R possibly damaging Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1193:Rars UTSW 11 35809326 missense possibly damaging 0.92
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2055:Rars UTSW 11 35826583 splice site probably benign
R2294:Rars UTSW 11 35817536 splice site probably benign
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6550:Rars UTSW 11 35833183 missense probably benign 0.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7822:Rars UTSW 11 35819966 missense probably damaging 0.99
R7856:Rars UTSW 11 35808585 missense probably benign 0.09
R7939:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGACCCAGTACCAATCCTGA -3'
(R):5'- CCTGACTGTCTCCGGAACAC -3'

Sequencing Primer
(F):5'- TGAATACAAACCCACACGAGCTG -3'
(R):5'- TTAAAAGTGTGCATGCCCGC -3'
Posted On2015-06-20