Incidental Mutation 'R4281:Zfp692'
ID322908
Institutional Source Beutler Lab
Gene Symbol Zfp692
Ensembl Gene ENSMUSG00000037243
Gene Namezinc finger protein 692
SynonymsZfp692-ps
MMRRC Submission 041649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4281 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58307069-58314627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58314265 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 447 (F447L)
Ref Sequence ENSEMBL: ENSMUSP00000131896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049353] [ENSMUST00000057836] [ENSMUST00000064786] [ENSMUST00000108829] [ENSMUST00000153510] [ENSMUST00000155662] [ENSMUST00000186859]
Predicted Effect probably damaging
Transcript: ENSMUST00000049353
AA Change: F447L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131896
Gene: ENSMUSG00000037243
AA Change: F447L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057836
SMART Domains Protein: ENSMUSP00000060088
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064786
SMART Domains Protein: ENSMUSP00000070567
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108829
SMART Domains Protein: ENSMUSP00000104457
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153510
AA Change: F447L

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126674
Gene: ENSMUSG00000037243
AA Change: F447L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155662
SMART Domains Protein: ENSMUSP00000114561
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186859
SMART Domains Protein: ENSMUSP00000140236
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 1.8e-5 SMART
ZnF_C2H2 43 65 3.6e-2 SMART
ZnF_C2H2 71 90 6.1e-1 SMART
Meta Mutation Damage Score 0.7133 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 92% (44/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
B9d2 A G 7: 25,681,426 T14A possibly damaging Het
Cavin3 A C 7: 105,481,774 probably null Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Evc2 T C 5: 37,338,594 V16A probably benign Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Gimap8 A C 6: 48,658,820 R506S probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Gtf2a1l A G 17: 88,711,637 N383S possibly damaging Het
Hepacam2 G A 6: 3,475,938 T329I probably damaging Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Lrrc6 A T 15: 66,380,529 H429Q probably benign Het
Mark4 T C 7: 19,433,446 K456R probably benign Het
Nox4 A G 7: 87,297,524 I143V possibly damaging Het
Olfr530 A G 7: 140,373,472 I46T probably benign Het
Olfr746 T C 14: 50,653,572 C112R probably benign Het
Pcdh18 A G 3: 49,756,533 L111P possibly damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Pnpla6 T C 8: 3,521,513 L148P probably damaging Het
Prkdc A G 16: 15,806,099 probably null Het
Rars T C 11: 35,821,224 E275G probably damaging Het
Rasa3 A G 8: 13,588,946 V287A probably benign Het
Rimbp2 C T 5: 128,788,340 R641Q possibly damaging Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tmem132a C G 19: 10,861,726 E451Q possibly damaging Het
Tmem229b-ps A G 10: 53,475,378 noncoding transcript Het
Trim33 T A 3: 103,329,086 V504D probably damaging Het
Usp47 A T 7: 112,109,993 E1315D probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp612 A G 8: 110,090,059 I594V probably damaging Het
Zranb3 A C 1: 127,963,877 S787R possibly damaging Het
Other mutations in Zfp692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Zfp692 APN 11 58314029 missense possibly damaging 0.94
IGL00978:Zfp692 APN 11 58309998 missense possibly damaging 0.92
IGL01667:Zfp692 APN 11 58311553 missense probably damaging 1.00
IGL02209:Zfp692 APN 11 58313998 nonsense probably null
IGL02873:Zfp692 APN 11 58308939 missense probably damaging 1.00
R0255:Zfp692 UTSW 11 58310403 splice site probably benign
R0267:Zfp692 UTSW 11 58314314 missense possibly damaging 0.64
R0506:Zfp692 UTSW 11 58309055 nonsense probably null
R0554:Zfp692 UTSW 11 58314227 missense probably damaging 1.00
R0628:Zfp692 UTSW 11 58309623 missense probably damaging 1.00
R0712:Zfp692 UTSW 11 58314314 missense probably benign 0.00
R1112:Zfp692 UTSW 11 58311562 missense probably damaging 1.00
R1493:Zfp692 UTSW 11 58314040 missense probably damaging 1.00
R1768:Zfp692 UTSW 11 58310176 splice site probably benign
R1853:Zfp692 UTSW 11 58309979 missense possibly damaging 0.69
R3551:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R3552:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R4784:Zfp692 UTSW 11 58310171 missense probably null 0.12
R5150:Zfp692 UTSW 11 58307587 start codon destroyed probably null 0.77
R7035:Zfp692 UTSW 11 58309442 critical splice donor site probably null
R7343:Zfp692 UTSW 11 58311505 missense probably damaging 1.00
R7896:Zfp692 UTSW 11 58314236 missense probably damaging 1.00
R8071:Zfp692 UTSW 11 58307734 missense probably damaging 0.96
R8163:Zfp692 UTSW 11 58310373 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACCTTGTCATCCACAGACG -3'
(R):5'- AGTGGTAGAGATGCTAGCCC -3'

Sequencing Primer
(F):5'- GAGAAACCCCTGCAGTGAGTTC -3'
(R):5'- TAGAGATGCTAGCCCCCTCAG -3'
Posted On2015-06-20