Incidental Mutation 'R4281:4930415L06Rik'
ID322918
Institutional Source Beutler Lab
Gene Symbol 4930415L06Rik
Ensembl Gene ENSMUSG00000035387
Gene NameRIKEN cDNA 4930415L06 gene
Synonyms
MMRRC Submission 041649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4281 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location89930098-89932852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89932499 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 31 (W31R)
Ref Sequence ENSEMBL: ENSMUSP00000085471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088146]
Predicted Effect probably damaging
Transcript: ENSMUST00000088146
AA Change: W31R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085471
Gene: ENSMUSG00000035387
AA Change: W31R

DomainStartEndE-ValueType
SCOP:d1k5db_ 18 107 1e-22 SMART
Pfam:SMK-1 178 369 9e-72 PFAM
low complexity region 650 663 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 92% (44/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
B9d2 A G 7: 25,681,426 T14A possibly damaging Het
Cavin3 A C 7: 105,481,774 probably null Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Evc2 T C 5: 37,338,594 V16A probably benign Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Gimap8 A C 6: 48,658,820 R506S probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Gtf2a1l A G 17: 88,711,637 N383S possibly damaging Het
Hepacam2 G A 6: 3,475,938 T329I probably damaging Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Lrrc6 A T 15: 66,380,529 H429Q probably benign Het
Mark4 T C 7: 19,433,446 K456R probably benign Het
Nox4 A G 7: 87,297,524 I143V possibly damaging Het
Olfr530 A G 7: 140,373,472 I46T probably benign Het
Olfr746 T C 14: 50,653,572 C112R probably benign Het
Pcdh18 A G 3: 49,756,533 L111P possibly damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Pnpla6 T C 8: 3,521,513 L148P probably damaging Het
Prkdc A G 16: 15,806,099 probably null Het
Rars T C 11: 35,821,224 E275G probably damaging Het
Rasa3 A G 8: 13,588,946 V287A probably benign Het
Rimbp2 C T 5: 128,788,340 R641Q possibly damaging Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tmem132a C G 19: 10,861,726 E451Q possibly damaging Het
Tmem229b-ps A G 10: 53,475,378 noncoding transcript Het
Trim33 T A 3: 103,329,086 V504D probably damaging Het
Usp47 A T 7: 112,109,993 E1315D probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp612 A G 8: 110,090,059 I594V probably damaging Het
Zfp692 T C 11: 58,314,265 F447L probably damaging Het
Zranb3 A C 1: 127,963,877 S787R possibly damaging Het
Other mutations in 4930415L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:4930415L06Rik APN X 89931523 missense probably benign 0.17
IGL02226:4930415L06Rik APN X 89931912 missense probably damaging 0.99
R1980:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1981:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1982:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R2299:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2381:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R2895:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2896:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R4001:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4003:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4042:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4043:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4280:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4282:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
Z1088:4930415L06Rik UTSW X 89930236 missense unknown
Z1088:4930415L06Rik UTSW X 89930237 missense unknown
Z1176:4930415L06Rik UTSW X 89930241 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGATCTCTTGACAATCATTTGG -3'
(R):5'- AGAATTTTGACTGCGGCAACAG -3'

Sequencing Primer
(F):5'- GGAAATGTATTGCCATGCCG -3'
(R):5'- CAACAGTTCTGGCCAAGGTAGC -3'
Posted On2015-06-20