Incidental Mutation 'R4282:Kcnq2'
ID322931
Institutional Source Beutler Lab
Gene Symbol Kcnq2
Ensembl Gene ENSMUSG00000016346
Gene Namepotassium voltage-gated channel, subfamily Q, member 2
SynonymsKQT2, Nmf134
MMRRC Submission 041650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4282 (G1)
Quality Score174
Status Validated
Chromosome2
Chromosomal Location181075579-181135300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181081153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 810 (D810G)
Ref Sequence ENSEMBL: ENSMUSP00000143263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016491] [ENSMUST00000049792] [ENSMUST00000081528] [ENSMUST00000103047] [ENSMUST00000103048] [ENSMUST00000103050] [ENSMUST00000103051] [ENSMUST00000129695] [ENSMUST00000149964] [ENSMUST00000197015]
Predicted Effect probably benign
Transcript: ENSMUST00000016491
SMART Domains Protein: ENSMUSP00000016491
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.3e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 595 2e-59 PFAM
Pfam:KCNQ_channel 593 673 1.7e-22 PFAM
low complexity region 711 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049792
SMART Domains Protein: ENSMUSP00000052453
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.2e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 565 3.1e-55 PFAM
Pfam:KCNQ_channel 587 668 6.8e-23 PFAM
low complexity region 706 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081528
SMART Domains Protein: ENSMUSP00000080243
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 4.3e-29 PFAM
Pfam:Ion_trans_2 237 317 1.7e-14 PFAM
Pfam:KCNQ_channel 436 564 2.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103047
SMART Domains Protein: ENSMUSP00000099336
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.1e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 424 583 2e-59 PFAM
Pfam:KCNQ_channel 581 661 1.7e-22 PFAM
low complexity region 699 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103048
SMART Domains Protein: ENSMUSP00000099337
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 6.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.4e-14 PFAM
Pfam:KCNQ_channel 436 637 1.3e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103049
AA Change: D762G
SMART Domains Protein: ENSMUSP00000099338
Gene: ENSMUSG00000016346
AA Change: D762G

DomainStartEndE-ValueType
Pfam:Ion_trans 35 268 3.7e-32 PFAM
Pfam:Ion_trans_2 181 261 1.1e-14 PFAM
Pfam:KCNQ_channel 392 584 1e-92 PFAM
Pfam:KCNQ2_u3 591 679 3.9e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 692 791 1.1e-48 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103050
AA Change: D807G
SMART Domains Protein: ENSMUSP00000099339
Gene: ENSMUSG00000016346
AA Change: D807G

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103051
AA Change: D820G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099340
Gene: ENSMUSG00000016346
AA Change: D820G

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.9e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 446 647 1.7e-82 PFAM
low complexity region 685 697 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 747 849 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129073
SMART Domains Protein: ENSMUSP00000127061
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 1e-28 PFAM
Pfam:Ion_trans_2 237 317 3.4e-14 PFAM
Pfam:KCNQ_channel 436 565 3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129695
AA Change: D694G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123488
Gene: ENSMUSG00000016346
AA Change: D694G

DomainStartEndE-ValueType
Pfam:Ion_trans 14 198 6.8e-29 PFAM
Pfam:Ion_trans_2 123 203 2.4e-14 PFAM
Pfam:KCNQ_channel 320 521 1.3e-82 PFAM
low complexity region 559 571 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 621 723 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145861
Predicted Effect probably damaging
Transcript: ENSMUST00000149964
AA Change: D838G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122915
Gene: ENSMUSG00000016346
AA Change: D838G

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 4.4e-32 PFAM
Pfam:Ion_trans_2 237 317 1.3e-14 PFAM
low complexity region 418 431 N/A INTRINSIC
Pfam:KCNQ_channel 466 659 6.2e-94 PFAM
Pfam:KCNQ2_u3 666 754 4.5e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 767 866 1.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152099
Predicted Effect probably damaging
Transcript: ENSMUST00000197015
AA Change: D810G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143263
Gene: ENSMUSG00000016346
AA Change: D810G

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197599
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die perinatally with pulmonary atelectasis. Heterozygous mice exhibit a hypersensitivity to the epileptic inducer pentylenetetrazole. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
1700092K14Rik A C 11: 114,199,144 noncoding transcript Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Abca17 G T 17: 24,299,060 D758E possibly damaging Het
Adam28 A G 14: 68,647,706 V65A possibly damaging Het
Adgra2 T A 8: 27,119,244 M616K possibly damaging Het
Aldh3b2 A G 19: 3,977,636 D59G probably benign Het
Ankrd28 A G 14: 31,745,225 V260A possibly damaging Het
Bbs7 A G 3: 36,573,571 V689A probably damaging Het
Cacna1e A G 1: 154,426,550 F1653S probably benign Het
Cd55b T C 1: 130,416,859 D213G probably damaging Het
Colgalt2 G A 1: 152,468,531 V115M probably damaging Het
Ddx60 T C 8: 61,994,393 V1138A probably damaging Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Dus2 C T 8: 106,048,654 A271V probably benign Het
Fabp3 C T 4: 130,312,452 probably null Het
Fancg T C 4: 43,003,830 D533G probably damaging Het
Frem3 T C 8: 80,614,141 V1021A probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hspb6 T C 7: 30,553,464 S44P possibly damaging Het
Jsrp1 T C 10: 80,810,356 I50V probably benign Het
Kansl1 T C 11: 104,378,689 N476S probably benign Het
Maml2 C A 9: 13,620,110 L207I possibly damaging Het
Myo3a A T 2: 22,340,278 E508D probably benign Het
Nav1 T A 1: 135,457,913 probably benign Het
Ndrg3 A T 2: 156,948,294 C90S possibly damaging Het
Orc1 A G 4: 108,606,274 S663G probably benign Het
Pcdhb14 T A 18: 37,450,142 L767H probably damaging Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Por C A 5: 135,715,961 T26K possibly damaging Het
Qsox1 T A 1: 155,786,925 probably null Het
Rad51ap2 T A 12: 11,456,464 V129D probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Rxfp2 T G 5: 150,070,270 V585G possibly damaging Het
Sftpd G A 14: 41,172,580 T294I probably benign Het
Sh3gl1 A G 17: 56,036,456 S2P probably damaging Het
Slc38a10 A T 11: 120,129,264 F321I probably damaging Het
Slc4a10 T A 2: 62,244,343 probably null Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Slit1 T C 19: 41,614,417 E985G probably benign Het
Smurf1 C T 5: 144,882,593 E575K probably damaging Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tmem182 T C 1: 40,838,370 I135T probably damaging Het
Tmem67 T C 4: 12,073,922 Y298C probably damaging Het
Trappc9 A G 15: 72,590,792 C1026R probably damaging Het
Troap A G 15: 99,078,832 D279G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r25 A T 6: 123,823,647 C579S probably damaging Het
Zbtb18 A G 1: 177,447,479 D126G probably damaging Het
Other mutations in Kcnq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Kcnq2 APN 2 181109789 unclassified probably benign
IGL02064:Kcnq2 APN 2 181109026 missense probably damaging 1.00
IGL02231:Kcnq2 APN 2 181081715 missense probably benign 0.22
IGL02261:Kcnq2 APN 2 181081690 missense probably damaging 0.98
IGL02510:Kcnq2 APN 2 181081361 missense probably benign
IGL02583:Kcnq2 APN 2 181081502 missense probably benign 0.01
IGL02627:Kcnq2 APN 2 181082327 unclassified probably benign
IGL03303:Kcnq2 APN 2 181082389 missense probably benign
R0269:Kcnq2 UTSW 2 181096974 missense probably benign 0.00
R1535:Kcnq2 UTSW 2 181134825 missense probably damaging 1.00
R1688:Kcnq2 UTSW 2 181087033 missense probably damaging 1.00
R1776:Kcnq2 UTSW 2 181100557 missense probably benign 0.01
R1946:Kcnq2 UTSW 2 181088451 missense probably benign 0.09
R2105:Kcnq2 UTSW 2 181081352 missense probably benign 0.03
R2382:Kcnq2 UTSW 2 181112107 missense probably damaging 1.00
R2912:Kcnq2 UTSW 2 181081774 missense probably damaging 1.00
R3826:Kcnq2 UTSW 2 181104900 missense possibly damaging 0.56
R3898:Kcnq2 UTSW 2 181109686 missense probably damaging 0.97
R4938:Kcnq2 UTSW 2 181086973 missense probably damaging 0.96
R4962:Kcnq2 UTSW 2 181112043 missense possibly damaging 0.59
R5055:Kcnq2 UTSW 2 181086761 intron probably benign
R5107:Kcnq2 UTSW 2 181108547 intron probably benign
R5371:Kcnq2 UTSW 2 181135020 missense probably damaging 1.00
R5557:Kcnq2 UTSW 2 181134897 missense probably benign 0.07
R5839:Kcnq2 UTSW 2 181109751 missense probably damaging 1.00
R5998:Kcnq2 UTSW 2 181087008 missense probably damaging 1.00
R6084:Kcnq2 UTSW 2 181087656 missense possibly damaging 0.53
R6207:Kcnq2 UTSW 2 181113233 missense possibly damaging 0.49
R6744:Kcnq2 UTSW 2 181085306 missense possibly damaging 0.94
R7018:Kcnq2 UTSW 2 181081724 nonsense probably null
R7266:Kcnq2 UTSW 2 181135092 start codon destroyed probably null 0.92
R7291:Kcnq2 UTSW 2 181088379 missense possibly damaging 0.69
R7319:Kcnq2 UTSW 2 181109102 missense probably damaging 1.00
R7447:Kcnq2 UTSW 2 181113094 missense probably damaging 0.97
R7573:Kcnq2 UTSW 2 181081589 missense probably benign 0.04
R7897:Kcnq2 UTSW 2 181081141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGAAAGGCCCTGGAACTCC -3'
(R):5'- TACCGAGTTCTTGAGGCTGG -3'

Sequencing Primer
(F):5'- TCCAGTTCTAAAACCGAACAAGAGTG -3'
(R):5'- TCTTGAGGCTGGAGGGCAC -3'
Posted On2015-06-20