Incidental Mutation 'R0003:Lama5'
ID 32294
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Name laminin, alpha 5
Synonyms
MMRRC Submission 038299-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0003 (G1)
Quality Score 81
Status Not validated
Chromosome 2
Chromosomal Location 179818166-179867652 bp(-) (GRCm39)
Type of Mutation splice site (1793 bp from exon)
DNA Base Change (assembly) T to G at 179819872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
AlphaFold no structure available at present
PDB Structure Crystal structure of the proteasomal Rpn13 PRU-domain [X-RAY DIFFRACTION]
Complex Structures of Mouse Rpn13 (22-130aa) and ubiquitin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000015791
AA Change: Q3402P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: Q3402P

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,019,616 (GRCm39) C439S probably damaging Het
Adnp2 T C 18: 80,174,205 (GRCm39) Y68C probably damaging Het
Ahctf1 A T 1: 179,591,038 (GRCm39) D1247E probably benign Het
Alms1 T A 6: 85,606,192 (GRCm39) M2614K possibly damaging Het
Alx3 A G 3: 107,512,292 (GRCm39) H310R probably damaging Het
Ambra1 C T 2: 91,741,773 (GRCm39) T1016M probably damaging Het
Ankrd35 A G 3: 96,591,331 (GRCm39) E539G probably damaging Het
Aptx A G 4: 40,695,145 (GRCm39) probably benign Het
Arsi C T 18: 61,050,058 (GRCm39) R314C probably benign Het
Atp1a3 T C 7: 24,688,989 (GRCm39) probably benign Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
Bicra G T 7: 15,705,812 (GRCm39) T1543K probably benign Het
Bltp2 T A 11: 78,177,404 (GRCm39) V1903E possibly damaging Het
Bzw2 A C 12: 36,180,014 (GRCm39) I71S probably damaging Het
Camk2a C T 18: 61,093,079 (GRCm39) A302V probably damaging Het
Ccdc12 A G 9: 110,485,665 (GRCm39) E12G possibly damaging Het
Cd300lb A T 11: 114,819,164 (GRCm39) F19Y probably benign Het
Clcn3 A T 8: 61,380,330 (GRCm39) C535* probably null Het
Cntnap5c A G 17: 58,506,012 (GRCm39) T679A probably benign Het
Cpsf7 G A 19: 10,516,993 (GRCm39) S365N possibly damaging Het
Cspg4b T A 13: 113,505,310 (GRCm39) S2146R probably benign Het
Cyp20a1 T C 1: 60,426,285 (GRCm39) probably benign Het
Decr2 A T 17: 26,302,027 (GRCm39) N234K probably benign Het
Def8 G A 8: 124,183,234 (GRCm39) A278T probably damaging Het
Dnah12 T C 14: 26,494,601 (GRCm39) F1300L probably damaging Het
Dock1 T C 7: 134,331,793 (GRCm39) probably benign Het
Dpy19l4 A T 4: 11,267,619 (GRCm39) N440K probably damaging Het
Eprs1 T C 1: 185,146,588 (GRCm39) V1206A probably damaging Het
Exoc6b A G 6: 84,831,681 (GRCm39) probably null Het
Fam184b A G 5: 45,712,536 (GRCm39) probably benign Het
Fcho1 A T 8: 72,161,597 (GRCm39) S858T probably damaging Het
Fgfr1 A G 8: 26,058,214 (GRCm39) D430G possibly damaging Het
Fmnl3 T C 15: 99,219,013 (GRCm39) T807A probably damaging Het
Gabra5 T C 7: 57,063,476 (GRCm39) Y316C probably damaging Het
Gh A G 11: 106,192,346 (GRCm39) L16P probably damaging Het
Glipr2 A T 4: 43,970,532 (GRCm39) I87F probably damaging Het
Glrb T A 3: 80,763,221 (GRCm39) I259F probably damaging Het
Gpr63 T C 4: 25,007,651 (GRCm39) L125P probably damaging Het
Grb2 A G 11: 115,546,251 (GRCm39) Y37H probably damaging Het
Haus2 G A 2: 120,449,449 (GRCm39) probably benign Het
Hmgcr T C 13: 96,788,653 (GRCm39) N749S probably damaging Het
Igf1r T C 7: 67,814,990 (GRCm39) V297A probably damaging Het
Il12rb2 G T 6: 67,293,270 (GRCm39) P69H probably damaging Het
Ints3 C A 3: 90,315,818 (GRCm39) M315I probably benign Het
Izumo2 C T 7: 44,364,833 (GRCm39) T116I probably benign Het
Kctd19 A C 8: 106,121,993 (GRCm39) Y185D probably damaging Het
Lama4 A G 10: 38,936,218 (GRCm39) N631S possibly damaging Het
Lamc1 A C 1: 153,138,185 (GRCm39) L223R probably damaging Het
Lgr4 G A 2: 109,828,010 (GRCm39) probably null Het
Loxhd1 T C 18: 77,427,196 (GRCm39) L398P probably damaging Het
Mapk9 T A 11: 49,757,866 (GRCm39) D103E possibly damaging Het
Marchf6 T C 15: 31,469,678 (GRCm39) probably benign Het
Mlxipl G A 5: 135,162,043 (GRCm39) probably benign Het
Mrgbp C A 2: 180,225,231 (GRCm39) D62E probably benign Het
Mtap A T 4: 89,070,235 (GRCm39) probably benign Het
Myt1 G A 2: 181,443,664 (GRCm39) G497S probably damaging Het
Naa25 T G 5: 121,545,247 (GRCm39) probably benign Het
Nfat5 C T 8: 108,065,707 (GRCm39) R156W probably damaging Het
Nkpd1 T C 7: 19,253,852 (GRCm39) C73R probably benign Het
Nup210l T C 3: 90,027,218 (GRCm39) I200T probably damaging Het
Nvl C A 1: 180,941,698 (GRCm39) D581Y probably damaging Het
Or51a6 T C 7: 102,604,185 (GRCm39) M208V probably benign Het
Or51f2 T C 7: 102,527,068 (GRCm39) V247A probably benign Het
Or5t17 T A 2: 86,832,710 (GRCm39) Y132* probably null Het
Or8b1c A G 9: 38,384,612 (GRCm39) T190A probably benign Het
Or9q1 T C 19: 13,805,050 (GRCm39) T237A probably damaging Het
Pcdh7 G T 5: 58,070,590 (GRCm39) E1089D probably benign Het
Pik3cd A G 4: 149,740,836 (GRCm39) probably null Het
Plekhh2 A T 17: 84,864,820 (GRCm39) K69N probably damaging Het
Ptgdr2 G A 19: 10,917,792 (GRCm39) C103Y probably damaging Het
Rrad A C 8: 105,355,299 (GRCm39) H236Q probably benign Het
Rslcan18 C T 13: 67,246,533 (GRCm39) A236T probably benign Het
Ryr2 C A 13: 11,839,265 (GRCm39) D503Y probably damaging Het
Siglec1 T C 2: 130,916,980 (GRCm39) T1092A probably benign Het
Siglecf A G 7: 43,005,350 (GRCm39) T437A probably benign Het
Spta1 A T 1: 174,032,839 (GRCm39) Q965H probably damaging Het
Stk10 A T 11: 32,539,460 (GRCm39) E280V probably benign Het
Tfg T C 16: 56,511,351 (GRCm39) Y326C possibly damaging Het
Tpp2 T A 1: 43,999,299 (GRCm39) S358T possibly damaging Het
Trim25 G T 11: 88,906,598 (GRCm39) V437L probably benign Het
Ttn T C 2: 76,574,027 (GRCm39) D25622G probably damaging Het
Ube3b T A 5: 114,536,912 (GRCm39) S303R probably benign Het
Ush2a T A 1: 188,310,688 (GRCm39) V2088D probably damaging Het
Vmn2r103 A G 17: 20,032,241 (GRCm39) T672A probably damaging Het
Wdr11 G T 7: 129,200,785 (GRCm39) G79C probably damaging Het
Wdr89 T A 12: 75,679,367 (GRCm39) T296S probably benign Het
Zdhhc24 T A 19: 4,930,402 (GRCm39) L179M possibly damaging Het
Zfp981 T C 4: 146,622,217 (GRCm39) C381R probably damaging Het
Zim1 A G 7: 6,679,947 (GRCm39) I572T probably benign Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 179,818,336 (GRCm39) unclassified probably benign
IGL01370:Lama5 APN 2 179,839,193 (GRCm39) missense possibly damaging 0.87
IGL01474:Lama5 APN 2 179,838,363 (GRCm39) missense probably damaging 1.00
IGL01614:Lama5 APN 2 179,822,657 (GRCm39) missense probably damaging 1.00
IGL01941:Lama5 APN 2 179,834,185 (GRCm39) missense possibly damaging 0.71
IGL01953:Lama5 APN 2 179,832,497 (GRCm39) missense probably damaging 0.97
IGL02093:Lama5 APN 2 179,830,380 (GRCm39) missense probably damaging 1.00
IGL02197:Lama5 APN 2 179,849,012 (GRCm39) missense possibly damaging 0.82
IGL02308:Lama5 APN 2 179,832,120 (GRCm39) splice site probably benign
IGL02314:Lama5 APN 2 179,836,275 (GRCm39) splice site probably benign
IGL02317:Lama5 APN 2 179,833,112 (GRCm39) missense probably damaging 1.00
IGL02354:Lama5 APN 2 179,835,677 (GRCm39) nonsense probably null
IGL02361:Lama5 APN 2 179,835,677 (GRCm39) nonsense probably null
IGL02557:Lama5 APN 2 179,832,725 (GRCm39) nonsense probably null
IGL03026:Lama5 APN 2 179,837,760 (GRCm39) missense probably benign 0.34
IGL03160:Lama5 APN 2 179,822,128 (GRCm39) missense probably damaging 1.00
IGL03238:Lama5 APN 2 179,830,367 (GRCm39) missense probably benign
IGL03390:Lama5 APN 2 179,849,011 (GRCm39) missense probably damaging 1.00
blancmange UTSW 2 179,822,404 (GRCm39) missense probably damaging 0.98
cupcake UTSW 2 179,827,752 (GRCm39) missense probably damaging 1.00
layercake UTSW 2 179,822,511 (GRCm39) missense possibly damaging 0.83
poundcake UTSW 2 179,837,401 (GRCm39) missense probably damaging 1.00
Salty UTSW 2 179,823,444 (GRCm39) missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 179,831,238 (GRCm39) missense possibly damaging 0.89
R0056:Lama5 UTSW 2 179,828,899 (GRCm39) intron probably benign
R0147:Lama5 UTSW 2 179,832,199 (GRCm39) missense probably benign
R0148:Lama5 UTSW 2 179,832,199 (GRCm39) missense probably benign
R0310:Lama5 UTSW 2 179,823,359 (GRCm39) splice site probably benign
R0326:Lama5 UTSW 2 179,824,219 (GRCm39) missense possibly damaging 0.90
R0368:Lama5 UTSW 2 179,823,023 (GRCm39) nonsense probably null
R0479:Lama5 UTSW 2 179,826,250 (GRCm39) missense probably benign 0.03
R0490:Lama5 UTSW 2 179,821,962 (GRCm39) missense possibly damaging 0.90
R0636:Lama5 UTSW 2 179,831,124 (GRCm39) critical splice donor site probably null
R0704:Lama5 UTSW 2 179,821,277 (GRCm39) missense possibly damaging 0.84
R0733:Lama5 UTSW 2 179,822,511 (GRCm39) missense possibly damaging 0.83
R1017:Lama5 UTSW 2 179,837,213 (GRCm39) missense probably damaging 1.00
R1078:Lama5 UTSW 2 179,821,557 (GRCm39) unclassified probably benign
R1294:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1423:Lama5 UTSW 2 179,837,434 (GRCm39) missense probably damaging 1.00
R1438:Lama5 UTSW 2 179,824,593 (GRCm39) missense probably benign 0.01
R1447:Lama5 UTSW 2 179,827,671 (GRCm39) missense probably damaging 0.99
R1540:Lama5 UTSW 2 179,821,944 (GRCm39) missense probably benign
R1601:Lama5 UTSW 2 179,839,538 (GRCm39) missense probably damaging 1.00
R1624:Lama5 UTSW 2 179,848,551 (GRCm39) missense probably benign 0.02
R1674:Lama5 UTSW 2 179,843,780 (GRCm39) missense probably benign 0.00
R1687:Lama5 UTSW 2 179,835,859 (GRCm39) missense probably benign 0.00
R1696:Lama5 UTSW 2 179,844,279 (GRCm39) missense probably damaging 1.00
R1701:Lama5 UTSW 2 179,863,162 (GRCm39) missense probably damaging 1.00
R1778:Lama5 UTSW 2 179,837,274 (GRCm39) splice site probably benign
R1936:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1939:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1940:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1953:Lama5 UTSW 2 179,832,540 (GRCm39) missense possibly damaging 0.94
R1966:Lama5 UTSW 2 179,830,145 (GRCm39) missense probably damaging 1.00
R2024:Lama5 UTSW 2 179,820,923 (GRCm39) missense probably benign 0.00
R2079:Lama5 UTSW 2 179,867,301 (GRCm39) missense possibly damaging 0.68
R2115:Lama5 UTSW 2 179,828,678 (GRCm39) missense probably damaging 1.00
R2173:Lama5 UTSW 2 179,838,035 (GRCm39) missense probably benign 0.00
R2272:Lama5 UTSW 2 179,820,396 (GRCm39) missense possibly damaging 0.93
R2357:Lama5 UTSW 2 179,821,890 (GRCm39) missense probably benign 0.01
R2860:Lama5 UTSW 2 179,829,040 (GRCm39) missense probably benign 0.00
R2861:Lama5 UTSW 2 179,829,040 (GRCm39) missense probably benign 0.00
R2939:Lama5 UTSW 2 179,840,747 (GRCm39) missense probably damaging 1.00
R3053:Lama5 UTSW 2 179,824,860 (GRCm39) missense probably damaging 0.99
R3430:Lama5 UTSW 2 179,838,110 (GRCm39) missense probably benign 0.00
R3752:Lama5 UTSW 2 179,829,015 (GRCm39) missense probably damaging 1.00
R3782:Lama5 UTSW 2 179,836,356 (GRCm39) missense possibly damaging 0.57
R3901:Lama5 UTSW 2 179,824,144 (GRCm39) splice site probably benign
R4248:Lama5 UTSW 2 179,822,220 (GRCm39) missense possibly damaging 0.84
R4626:Lama5 UTSW 2 179,826,253 (GRCm39) missense probably damaging 0.98
R4638:Lama5 UTSW 2 179,832,206 (GRCm39) missense possibly damaging 0.89
R4669:Lama5 UTSW 2 179,822,430 (GRCm39) missense probably damaging 1.00
R4673:Lama5 UTSW 2 179,841,059 (GRCm39) missense probably damaging 1.00
R4677:Lama5 UTSW 2 179,821,159 (GRCm39) missense possibly damaging 0.69
R4701:Lama5 UTSW 2 179,833,489 (GRCm39) missense probably damaging 1.00
R4774:Lama5 UTSW 2 179,827,734 (GRCm39) missense probably damaging 1.00
R4880:Lama5 UTSW 2 179,818,861 (GRCm39) unclassified probably benign
R4923:Lama5 UTSW 2 179,825,942 (GRCm39) missense probably benign 0.18
R4960:Lama5 UTSW 2 179,850,045 (GRCm39) critical splice donor site probably null
R4983:Lama5 UTSW 2 179,835,242 (GRCm39) missense probably benign 0.13
R5061:Lama5 UTSW 2 179,840,579 (GRCm39) nonsense probably null
R5080:Lama5 UTSW 2 179,848,993 (GRCm39) nonsense probably null
R5135:Lama5 UTSW 2 179,844,013 (GRCm39) missense possibly damaging 0.89
R5206:Lama5 UTSW 2 179,833,097 (GRCm39) missense probably damaging 1.00
R5296:Lama5 UTSW 2 179,835,594 (GRCm39) missense probably damaging 1.00
R5319:Lama5 UTSW 2 179,822,911 (GRCm39) missense probably damaging 1.00
R5355:Lama5 UTSW 2 179,823,444 (GRCm39) missense possibly damaging 0.84
R5388:Lama5 UTSW 2 179,832,539 (GRCm39) missense possibly damaging 0.83
R5528:Lama5 UTSW 2 179,836,356 (GRCm39) missense probably benign 0.21
R5536:Lama5 UTSW 2 179,831,142 (GRCm39) missense probably damaging 0.99
R5658:Lama5 UTSW 2 179,850,069 (GRCm39) nonsense probably null
R5823:Lama5 UTSW 2 179,834,285 (GRCm39) missense probably benign 0.04
R5885:Lama5 UTSW 2 179,843,624 (GRCm39) missense probably damaging 1.00
R5889:Lama5 UTSW 2 179,835,467 (GRCm39) intron probably benign
R5912:Lama5 UTSW 2 179,837,268 (GRCm39) missense probably damaging 1.00
R5955:Lama5 UTSW 2 179,839,267 (GRCm39) missense probably damaging 1.00
R6015:Lama5 UTSW 2 179,827,185 (GRCm39) missense probably benign 0.36
R6037:Lama5 UTSW 2 179,848,806 (GRCm39) missense probably damaging 1.00
R6037:Lama5 UTSW 2 179,848,806 (GRCm39) missense probably damaging 1.00
R6191:Lama5 UTSW 2 179,827,752 (GRCm39) missense probably damaging 1.00
R6191:Lama5 UTSW 2 179,822,404 (GRCm39) missense probably damaging 0.98
R6359:Lama5 UTSW 2 179,837,775 (GRCm39) missense probably benign 0.01
R6385:Lama5 UTSW 2 179,838,326 (GRCm39) missense probably damaging 1.00
R6406:Lama5 UTSW 2 179,839,257 (GRCm39) nonsense probably null
R6552:Lama5 UTSW 2 179,822,947 (GRCm39) missense probably damaging 0.98
R6632:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6633:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6645:Lama5 UTSW 2 179,821,463 (GRCm39) missense probably damaging 1.00
R6731:Lama5 UTSW 2 179,830,367 (GRCm39) missense probably benign 0.09
R6744:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6798:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6799:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6801:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6851:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6869:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6881:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6882:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6884:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R7022:Lama5 UTSW 2 179,822,524 (GRCm39) missense probably damaging 1.00
R7204:Lama5 UTSW 2 179,843,970 (GRCm39) missense probably damaging 1.00
R7207:Lama5 UTSW 2 179,848,877 (GRCm39) missense probably damaging 0.98
R7282:Lama5 UTSW 2 179,843,588 (GRCm39) missense probably damaging 1.00
R7367:Lama5 UTSW 2 179,834,751 (GRCm39) missense probably benign 0.01
R7410:Lama5 UTSW 2 179,844,183 (GRCm39) critical splice donor site probably null
R7699:Lama5 UTSW 2 179,822,654 (GRCm39) missense probably damaging 1.00
R7849:Lama5 UTSW 2 179,843,605 (GRCm39) missense probably damaging 1.00
R7909:Lama5 UTSW 2 179,834,069 (GRCm39) missense possibly damaging 0.95
R7948:Lama5 UTSW 2 179,843,994 (GRCm39) missense probably damaging 1.00
R8153:Lama5 UTSW 2 179,829,724 (GRCm39) missense probably benign 0.37
R8317:Lama5 UTSW 2 179,848,784 (GRCm39) missense probably damaging 1.00
R8351:Lama5 UTSW 2 179,837,401 (GRCm39) missense probably damaging 1.00
R8370:Lama5 UTSW 2 179,843,280 (GRCm39) missense possibly damaging 0.80
R8398:Lama5 UTSW 2 179,838,827 (GRCm39) critical splice donor site probably null
R8401:Lama5 UTSW 2 179,840,580 (GRCm39) missense probably damaging 1.00
R8404:Lama5 UTSW 2 179,837,015 (GRCm39) missense probably damaging 1.00
R8502:Lama5 UTSW 2 179,837,015 (GRCm39) missense probably damaging 1.00
R8694:Lama5 UTSW 2 179,822,677 (GRCm39) missense probably damaging 0.98
R8705:Lama5 UTSW 2 179,820,354 (GRCm39) missense probably damaging 1.00
R8732:Lama5 UTSW 2 179,828,481 (GRCm39) missense probably damaging 1.00
R8755:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R8786:Lama5 UTSW 2 179,838,100 (GRCm39) missense probably damaging 1.00
R8926:Lama5 UTSW 2 179,835,783 (GRCm39) missense probably benign 0.08
R8928:Lama5 UTSW 2 179,843,832 (GRCm39) missense probably damaging 1.00
R8953:Lama5 UTSW 2 179,835,313 (GRCm39) missense probably damaging 0.99
R8958:Lama5 UTSW 2 179,835,592 (GRCm39) missense probably benign
R9002:Lama5 UTSW 2 179,838,311 (GRCm39) missense probably damaging 1.00
R9081:Lama5 UTSW 2 179,833,930 (GRCm39) nonsense probably null
R9165:Lama5 UTSW 2 179,821,286 (GRCm39) missense probably damaging 0.99
R9233:Lama5 UTSW 2 179,840,502 (GRCm39) nonsense probably null
R9264:Lama5 UTSW 2 179,838,271 (GRCm39) splice site probably benign
R9311:Lama5 UTSW 2 179,838,275 (GRCm39) critical splice donor site probably null
R9443:Lama5 UTSW 2 179,843,522 (GRCm39) missense probably benign 0.00
R9488:Lama5 UTSW 2 179,823,234 (GRCm39) missense possibly damaging 0.95
R9674:Lama5 UTSW 2 179,840,267 (GRCm39) critical splice donor site probably null
R9684:Lama5 UTSW 2 179,849,038 (GRCm39) missense probably damaging 1.00
R9749:Lama5 UTSW 2 179,825,433 (GRCm39) missense probably benign 0.00
RF020:Lama5 UTSW 2 179,837,971 (GRCm39) missense probably benign
X0065:Lama5 UTSW 2 179,823,524 (GRCm39) missense probably benign 0.26
Z1177:Lama5 UTSW 2 179,832,507 (GRCm39) missense possibly damaging 0.95
Z1177:Lama5 UTSW 2 179,831,212 (GRCm39) missense probably damaging 1.00
Z1177:Lama5 UTSW 2 179,825,423 (GRCm39) missense probably benign 0.03
Z1177:Lama5 UTSW 2 179,840,603 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGCTTGGAACTGTAACTGCTG -3'
(R):5'- ATTGGAGGTATTGCCCGTGCTGAC -3'

Sequencing Primer
(F):5'- ACCACAAGCTGGATCTGCTG -3'
(R):5'- GTGCTGACACCATGCTTG -3'
Posted On 2013-05-09