Mutagenetix > Incidental Mutations

Incidental Mutation 'R0003:Lama5'

32294

Institutional Source

Beutler Lab

Gene Symbol

Lama5

Ensembl Gene

ENSMUSG00000015647

Gene Name

laminin, alpha 5

Synonyms

MMRRC Submission

038299-MU

Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0003 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

180176373-180225859 bp(-) (GRCm38)

Type of Mutation

unclassified (1793 bp from exon)

DNA Base Change (assembly)

T to G at 180178079 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000050076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]

PDB Structure

Crystal structure of the proteasomal Rpn13 PRU-domain [X-RAY DIFFRACTION]
Complex Structures of Mouse Rpn13 (22-130aa) and ubiquitin [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015791
AA Change: Q3402P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: Q3402P

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
LamNT	44	303	1.06e-132	SMART
EGF_Lam	305	361	4.35e-6	SMART
EGF_Lam	364	431	5.78e-11	SMART
EGF_Lam	434	476	1.32e-5	SMART
EGF_Lam	500	544	8.63e-10	SMART
EGF_Lam	547	590	1.16e-10	SMART
EGF_Lam	593	635	4.63e-10	SMART
EGF_Lam	638	680	6.25e-7	SMART
EGF_Lam	683	726	3.1e-11	SMART
EGF_Lam	730	779	2.99e-4	SMART
EGF_Lam	782	831	4.66e-6	SMART
EGF_Lam	834	878	3.48e-5	SMART
low complexity region	1261	1273	N/A	INTRINSIC
EGF_Lam	1443	1486	7.01e-10	SMART
EGF_like	1489	1530	3.64e-1	SMART
EGF_Lam	1533	1579	8.56e-14	SMART
EGF_Lam	1582	1630	1.86e-14	SMART
LamB	1689	1819	5.86e-61	SMART
EGF_like	1818	1862	2.74e0	SMART
EGF_Lam	1865	1912	3.32e-11	SMART
EGF_Lam	1915	1968	1.61e-9	SMART
EGF_Lam	1971	2022	6.39e-13	SMART
EGF_Lam	2025	2069	1.94e-12	SMART
EGF_Lam	2072	2116	1.35e-11	SMART
EGF_like	2103	2145	3.1e1	SMART
EGF_Lam	2119	2166	1.18e-2	SMART
Pfam:Laminin_I	2189	2453	1.7e-65	PFAM
low complexity region	2532	2548	N/A	INTRINSIC
low complexity region	2557	2569	N/A	INTRINSIC
low complexity region	2632	2641	N/A	INTRINSIC
low complexity region	2663	2676	N/A	INTRINSIC
LamG	2760	2912	3.97e-8	SMART
LamG	2966	3103	1.78e-10	SMART
LamG	3149	3274	1.11e-20	SMART
LamG	3359	3497	4.05e-23	SMART
LamG	3539	3670	3e-26	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000061437

SMART Domains

Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

Domain	Start	End	E-Value	Type
Pfam:Proteasom_Rpn13	29	111	3.5e-35	PFAM
low complexity region	135	161	N/A	INTRINSIC
low complexity region	173	254	N/A	INTRINSIC
Pfam:RPN13_C	268	381	7.3e-38	PFAM
low complexity region	390	403	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128029

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130796

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147341

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185089

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.7%

Validation Efficiency

94% (82/87)

MGI Phenotype

Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]

Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,286,578	V1903E	possibly damaging	Het
Adam19	T	A	11: 46,128,789	C439S	probably damaging	Het
Adnp2	T	C	18: 80,130,990	Y68C	probably damaging	Het
Ahctf1	A	T	1: 179,763,473	D1247E	probably benign	Het
Alms1	T	A	6: 85,629,210	M2614K	possibly damaging	Het
Alx3	A	G	3: 107,604,976	H310R	probably damaging	Het
Ambra1	C	T	2: 91,911,428	T1016M	probably damaging	Het
Ankrd35	A	G	3: 96,684,015	E539G	probably damaging	Het
Aptx	A	G	4: 40,695,145		probably benign	Het
Arsi	C	T	18: 60,916,986	R314C	probably benign	Het
Atp1a3	T	C	7: 24,989,564		probably benign	Het
Avl9	G	T	6: 56,736,483	R242L	probably benign	Het
BC067074	T	A	13: 113,368,776	S2146R	probably benign	Het
Bicra	G	T	7: 15,971,887	T1543K	probably benign	Het
Bzw2	A	C	12: 36,130,015	I71S	probably damaging	Het
Camk2a	C	T	18: 60,960,007	A302V	probably damaging	Het
Ccdc12	A	G	9: 110,656,597	E12G	possibly damaging	Het
Cd300lb	A	T	11: 114,928,338	F19Y	probably benign	Het
Clcn3	A	T	8: 60,927,296	C535*	probably null	Het
Cntnap5c	A	G	17: 58,199,017	T679A	probably benign	Het
Cpsf7	G	A	19: 10,539,629	S365N	possibly damaging	Het
Cyp20a1	T	C	1: 60,387,126		probably benign	Het
Decr2	A	T	17: 26,083,053	N234K	probably benign	Het
Def8	G	A	8: 123,456,495	A278T	probably damaging	Het
Dnah12	T	C	14: 26,772,644	F1300L	probably damaging	Het
Dock1	T	C	7: 134,730,064		probably benign	Het
Dpy19l4	A	T	4: 11,267,619	N440K	probably damaging	Het
Eprs	T	C	1: 185,414,391	V1206A	probably damaging	Het
Exoc6b	A	G	6: 84,854,699		probably null	Het
Fam184b	A	G	5: 45,555,194		probably benign	Het
Fcho1	A	T	8: 71,708,953	S858T	probably damaging	Het
Fgfr1	A	G	8: 25,568,198	D430G	possibly damaging	Het
Fmnl3	T	C	15: 99,321,132	T807A	probably damaging	Het
Gabra5	T	C	7: 57,413,728	Y316C	probably damaging	Het
Gh	A	G	11: 106,301,520	L16P	probably damaging	Het
Glipr2	A	T	4: 43,970,532	I87F	probably damaging	Het
Glrb	T	A	3: 80,855,914	I259F	probably damaging	Het
Gpr63	T	C	4: 25,007,651	L125P	probably damaging	Het
Grb2	A	G	11: 115,655,425	Y37H	probably damaging	Het
Haus2	G	A	2: 120,618,968		probably benign	Het
Hmgcr	T	C	13: 96,652,145	N749S	probably damaging	Het
Igf1r	T	C	7: 68,165,242	V297A	probably damaging	Het
Il12rb2	G	T	6: 67,316,286	P69H	probably damaging	Het
Ints3	C	A	3: 90,408,511	M315I	probably benign	Het
Izumo2	C	T	7: 44,715,409	T116I	probably benign	Het
Kctd19	A	C	8: 105,395,361	Y185D	probably damaging	Het
Lama4	A	G	10: 39,060,222	N631S	possibly damaging	Het
Lamc1	A	C	1: 153,262,439	L223R	probably damaging	Het
Lgr4	G	A	2: 109,997,665		probably null	Het
Loxhd1	T	C	18: 77,339,500	L398P	probably damaging	Het
Mapk9	T	A	11: 49,867,039	D103E	possibly damaging	Het
March6	T	C	15: 31,469,532		probably benign	Het
Mlxipl	G	A	5: 135,133,189		probably benign	Het
Mrgbp	C	A	2: 180,583,438	D62E	probably benign	Het
Mtap	A	T	4: 89,151,998		probably benign	Het
Myt1	G	A	2: 181,801,871	G497S	probably damaging	Het
Naa25	T	G	5: 121,407,184		probably benign	Het
Nfat5	C	T	8: 107,339,075	R156W	probably damaging	Het
Nkpd1	T	C	7: 19,519,927	C73R	probably benign	Het
Nup210l	T	C	3: 90,119,911	I200T	probably damaging	Het
Nvl	C	A	1: 181,114,133	D581Y	probably damaging	Het
Olfr1102	T	A	2: 87,002,366	Y132*	probably null	Het
Olfr1500	T	C	19: 13,827,686	T237A	probably damaging	Het
Olfr568	T	C	7: 102,877,861	V247A	probably benign	Het
Olfr575	T	C	7: 102,954,978	M208V	probably benign	Het
Olfr905	A	G	9: 38,473,316	T190A	probably benign	Het
Pcdh7	G	T	5: 57,913,248	E1089D	probably benign	Het
Pik3cd	A	G	4: 149,656,379		probably null	Het
Plekhh2	A	T	17: 84,557,392	K69N	probably damaging	Het
Ptgdr2	G	A	19: 10,940,428	C103Y	probably damaging	Het
Rrad	A	C	8: 104,628,667	H236Q	probably benign	Het
Rslcan18	C	T	13: 67,098,469	A236T	probably benign	Het
Ryr2	C	A	13: 11,824,379	D503Y	probably damaging	Het
Siglec1	T	C	2: 131,075,060	T1092A	probably benign	Het
Siglecf	A	G	7: 43,355,926	T437A	probably benign	Het
Spta1	A	T	1: 174,205,273	Q965H	probably damaging	Het
Stk10	A	T	11: 32,589,460	E280V	probably benign	Het
Tfg	T	C	16: 56,690,988	Y326C	possibly damaging	Het
Tpp2	T	A	1: 43,960,139	S358T	possibly damaging	Het
Trim25	G	T	11: 89,015,772	V437L	probably benign	Het
Ttn	T	C	2: 76,743,683	D25622G	probably damaging	Het
Ube3b	T	A	5: 114,398,851	S303R	probably benign	Het
Ush2a	T	A	1: 188,578,491	V2088D	probably damaging	Het
Vmn2r103	A	G	17: 19,811,979	T672A	probably damaging	Het
Wdr11	G	T	7: 129,599,061	G79C	probably damaging	Het
Wdr89	T	A	12: 75,632,593	T296S	probably benign	Het
Zdhhc24	T	A	19: 4,880,374	L179M	possibly damaging	Het
Zfp981	T	C	4: 146,537,760	C381R	probably damaging	Het
Zim1	A	G	7: 6,676,948	I572T	probably benign	Het

Other mutations in Lama5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Lama5	APN	2	180176543	unclassified	probably benign
IGL01370:Lama5	APN	2	180197400	missense	possibly damaging	0.87
IGL01474:Lama5	APN	2	180196570	missense	probably damaging	1.00
IGL01614:Lama5	APN	2	180180864	missense	probably damaging	1.00
IGL01941:Lama5	APN	2	180192392	missense	possibly damaging	0.71
IGL01953:Lama5	APN	2	180190704	missense	probably damaging	0.97
IGL02093:Lama5	APN	2	180188587	missense	probably damaging	1.00
IGL02197:Lama5	APN	2	180207219	missense	possibly damaging	0.82
IGL02308:Lama5	APN	2	180190327	splice site	probably benign
IGL02314:Lama5	APN	2	180194482	splice site	probably benign
IGL02317:Lama5	APN	2	180191319	missense	probably damaging	1.00
IGL02354:Lama5	APN	2	180193884	nonsense	probably null
IGL02361:Lama5	APN	2	180193884	nonsense	probably null
IGL02557:Lama5	APN	2	180190932	nonsense	probably null
IGL03026:Lama5	APN	2	180195967	missense	probably benign	0.34
IGL03160:Lama5	APN	2	180180335	missense	probably damaging	1.00
IGL03238:Lama5	APN	2	180188574	missense	probably benign
IGL03390:Lama5	APN	2	180207218	missense	probably damaging	1.00
Salty	UTSW	2	180181651	missense	possibly damaging	0.84
PIT4378001:Lama5	UTSW	2	180189445	missense	possibly damaging	0.89
R0056:Lama5	UTSW	2	180187106	intron	probably benign
R0147:Lama5	UTSW	2	180190406	missense	probably benign
R0148:Lama5	UTSW	2	180190406	missense	probably benign
R0310:Lama5	UTSW	2	180181566	splice site	probably benign
R0326:Lama5	UTSW	2	180182426	missense	possibly damaging	0.90
R0368:Lama5	UTSW	2	180181230	nonsense	probably null
R0479:Lama5	UTSW	2	180184457	missense	probably benign	0.03
R0490:Lama5	UTSW	2	180180169	missense	possibly damaging	0.90
R0636:Lama5	UTSW	2	180189331	critical splice donor site	probably null
R0704:Lama5	UTSW	2	180179484	missense	possibly damaging	0.84
R0733:Lama5	UTSW	2	180180718	missense	possibly damaging	0.83
R1017:Lama5	UTSW	2	180195420	missense	probably damaging	1.00
R1078:Lama5	UTSW	2	180179764	unclassified	probably benign
R1294:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1423:Lama5	UTSW	2	180195641	missense	probably damaging	1.00
R1438:Lama5	UTSW	2	180182800	missense	probably benign	0.01
R1447:Lama5	UTSW	2	180185878	missense	probably damaging	0.99
R1540:Lama5	UTSW	2	180180151	missense	probably benign
R1601:Lama5	UTSW	2	180197745	missense	probably damaging	1.00
R1624:Lama5	UTSW	2	180206758	missense	probably benign	0.02
R1674:Lama5	UTSW	2	180201987	missense	probably benign	0.00
R1687:Lama5	UTSW	2	180194066	missense	probably benign	0.00
R1696:Lama5	UTSW	2	180202486	missense	probably damaging	1.00
R1701:Lama5	UTSW	2	180221369	missense	probably damaging	1.00
R1778:Lama5	UTSW	2	180195481	splice site	probably benign
R1936:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1939:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1940:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1953:Lama5	UTSW	2	180190747	missense	possibly damaging	0.94
R1966:Lama5	UTSW	2	180188352	missense	probably damaging	1.00
R2024:Lama5	UTSW	2	180179130	missense	probably benign	0.00
R2079:Lama5	UTSW	2	180225508	missense	possibly damaging	0.68
R2115:Lama5	UTSW	2	180186885	missense	probably damaging	1.00
R2173:Lama5	UTSW	2	180196242	missense	probably benign	0.00
R2272:Lama5	UTSW	2	180178603	missense	possibly damaging	0.93
R2357:Lama5	UTSW	2	180180097	missense	probably benign	0.01
R2860:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2861:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2939:Lama5	UTSW	2	180198954	missense	probably damaging	1.00
R3053:Lama5	UTSW	2	180183067	missense	probably damaging	0.99
R3430:Lama5	UTSW	2	180196317	missense	probably benign	0.00
R3752:Lama5	UTSW	2	180187222	missense	probably damaging	1.00
R3782:Lama5	UTSW	2	180194563	missense	possibly damaging	0.57
R3901:Lama5	UTSW	2	180182351	splice site	probably benign
R4248:Lama5	UTSW	2	180180427	missense	possibly damaging	0.84
R4626:Lama5	UTSW	2	180184460	missense	probably damaging	0.98
R4638:Lama5	UTSW	2	180190413	missense	possibly damaging	0.89
R4669:Lama5	UTSW	2	180180637	missense	probably damaging	1.00
R4673:Lama5	UTSW	2	180199266	missense	probably damaging	1.00
R4677:Lama5	UTSW	2	180179366	missense	possibly damaging	0.69
R4701:Lama5	UTSW	2	180191696	missense	probably damaging	1.00
R4774:Lama5	UTSW	2	180185941	missense	probably damaging	1.00
R4880:Lama5	UTSW	2	180177068	unclassified	probably benign
R4923:Lama5	UTSW	2	180184149	missense	probably benign	0.18
R4960:Lama5	UTSW	2	180208252	critical splice donor site	probably null
R4983:Lama5	UTSW	2	180193449	missense	probably benign	0.13
R5061:Lama5	UTSW	2	180198786	nonsense	probably null
R5080:Lama5	UTSW	2	180207200	nonsense	probably null
R5135:Lama5	UTSW	2	180202220	missense	possibly damaging	0.89
R5206:Lama5	UTSW	2	180191304	missense	probably damaging	1.00
R5296:Lama5	UTSW	2	180193801	missense	probably damaging	1.00
R5319:Lama5	UTSW	2	180181118	missense	probably damaging	1.00
R5355:Lama5	UTSW	2	180181651	missense	possibly damaging	0.84
R5388:Lama5	UTSW	2	180190746	missense	possibly damaging	0.83
R5528:Lama5	UTSW	2	180194563	missense	probably benign	0.21
R5536:Lama5	UTSW	2	180189349	missense	probably damaging	0.99
R5658:Lama5	UTSW	2	180208276	nonsense	probably null
R5823:Lama5	UTSW	2	180192492	missense	probably benign	0.04
R5885:Lama5	UTSW	2	180201831	missense	probably damaging	1.00
R5889:Lama5	UTSW	2	180193674	intron	probably benign
R5912:Lama5	UTSW	2	180195475	missense	probably damaging	1.00
R5955:Lama5	UTSW	2	180197474	missense	probably damaging	1.00
R6015:Lama5	UTSW	2	180185392	missense	probably benign	0.36
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6191:Lama5	UTSW	2	180180611	missense	probably damaging	0.98
R6191:Lama5	UTSW	2	180185959	missense	probably damaging	1.00
R6359:Lama5	UTSW	2	180195982	missense	probably benign	0.01
R6385:Lama5	UTSW	2	180196533	missense	probably damaging	1.00
R6406:Lama5	UTSW	2	180197464	nonsense	probably null
R6552:Lama5	UTSW	2	180181154	missense	probably damaging	0.98
R6632:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6633:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6645:Lama5	UTSW	2	180179670	missense	probably damaging	1.00
R6731:Lama5	UTSW	2	180188574	missense	probably benign	0.09
R6744:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6798:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6799:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6801:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6851:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6869:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6881:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6882:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6884:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R7022:Lama5	UTSW	2	180180731	missense	probably damaging	1.00
R7204:Lama5	UTSW	2	180202177	missense	probably damaging	1.00
R7207:Lama5	UTSW	2	180207084	missense	probably damaging	0.98
R7282:Lama5	UTSW	2	180201795	missense	probably damaging	1.00
R7367:Lama5	UTSW	2	180192958	missense	probably benign	0.01
R7410:Lama5	UTSW	2	180202390	critical splice donor site	probably null
R7849:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7909:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
R7932:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7948:Lama5	UTSW	2	180202201	missense	probably damaging	1.00
R7990:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
RF020:Lama5	UTSW	2	180196178	missense	probably benign
X0065:Lama5	UTSW	2	180181731	missense	probably benign	0.26
Z1177:Lama5	UTSW	2	180183630	missense	probably benign	0.03
Z1177:Lama5	UTSW	2	180189419	missense	probably damaging	1.00
Z1177:Lama5	UTSW	2	180190714	missense	possibly damaging	0.95
Z1177:Lama5	UTSW	2	180198810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAGCTTGGAACTGTAACTGCTG -3'
(R):5'- ATTGGAGGTATTGCCCGTGCTGAC -3'

Sequencing Primer
(F):5'- ACCACAAGCTGGATCTGCTG -3'
(R):5'- GTGCTGACACCATGCTTG -3'

Posted On

2013-05-09