Incidental Mutation 'R0003:Lama5'
ID32294
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 038299-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0003 (G1)
Quality Score81
Status Not validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationunclassified (1793 bp from exon)
DNA Base Change (assembly) T to G at 180178079 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
PDB Structure
Crystal structure of the proteasomal Rpn13 PRU-domain [X-RAY DIFFRACTION]
Complex Structures of Mouse Rpn13 (22-130aa) and ubiquitin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000015791
AA Change: Q3402P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: Q3402P

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dock1 T C 7: 134,730,064 probably benign Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Igf1r T C 7: 68,165,242 V297A probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Tpp2 T A 1: 43,960,139 S358T possibly damaging Het
Trim25 G T 11: 89,015,772 V437L probably benign Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr11 G T 7: 129,599,061 G79C probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
R7367:Lama5 UTSW 2 180192958 missense probably benign 0.01
R7410:Lama5 UTSW 2 180202390 critical splice donor site probably null
R7849:Lama5 UTSW 2 180201812 missense probably damaging 1.00
R7909:Lama5 UTSW 2 180192276 missense possibly damaging 0.95
R7932:Lama5 UTSW 2 180201812 missense probably damaging 1.00
R7948:Lama5 UTSW 2 180202201 missense probably damaging 1.00
R7990:Lama5 UTSW 2 180192276 missense possibly damaging 0.95
RF020:Lama5 UTSW 2 180196178 missense probably benign
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Z1177:Lama5 UTSW 2 180183630 missense probably benign 0.03
Z1177:Lama5 UTSW 2 180189419 missense probably damaging 1.00
Z1177:Lama5 UTSW 2 180190714 missense possibly damaging 0.95
Z1177:Lama5 UTSW 2 180198810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGCTTGGAACTGTAACTGCTG -3'
(R):5'- ATTGGAGGTATTGCCCGTGCTGAC -3'

Sequencing Primer
(F):5'- ACCACAAGCTGGATCTGCTG -3'
(R):5'- GTGCTGACACCATGCTTG -3'
Posted On2013-05-09