Incidental Mutation 'R4282:Kansl1'
ID322955
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene NameKAT8 regulatory NSL complex subunit 1
Synonyms1700081L11Rik
MMRRC Submission 041650-MU
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4282 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104333229-104468861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104378689 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 476 (N476S)
Ref Sequence ENSEMBL: ENSMUSP00000102590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
Predicted Effect probably benign
Transcript: ENSMUST00000018556
AA Change: N476S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: N476S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106971
AA Change: N476S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: N476S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106972
AA Change: N476S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: N476S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106977
AA Change: N476S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: N476S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
1700092K14Rik A C 11: 114,199,144 noncoding transcript Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Abca17 G T 17: 24,299,060 D758E possibly damaging Het
Adam28 A G 14: 68,647,706 V65A possibly damaging Het
Adgra2 T A 8: 27,119,244 M616K possibly damaging Het
Aldh3b2 A G 19: 3,977,636 D59G probably benign Het
Ankrd28 A G 14: 31,745,225 V260A possibly damaging Het
Bbs7 A G 3: 36,573,571 V689A probably damaging Het
Cacna1e A G 1: 154,426,550 F1653S probably benign Het
Cd55b T C 1: 130,416,859 D213G probably damaging Het
Colgalt2 G A 1: 152,468,531 V115M probably damaging Het
Ddx60 T C 8: 61,994,393 V1138A probably damaging Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Dus2 C T 8: 106,048,654 A271V probably benign Het
Fabp3 C T 4: 130,312,452 probably null Het
Fancg T C 4: 43,003,830 D533G probably damaging Het
Frem3 T C 8: 80,614,141 V1021A probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hspb6 T C 7: 30,553,464 S44P possibly damaging Het
Jsrp1 T C 10: 80,810,356 I50V probably benign Het
Kcnq2 T C 2: 181,081,153 D810G probably damaging Het
Maml2 C A 9: 13,620,110 L207I possibly damaging Het
Myo3a A T 2: 22,340,278 E508D probably benign Het
Nav1 T A 1: 135,457,913 probably benign Het
Ndrg3 A T 2: 156,948,294 C90S possibly damaging Het
Orc1 A G 4: 108,606,274 S663G probably benign Het
Pcdhb14 T A 18: 37,450,142 L767H probably damaging Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Por C A 5: 135,715,961 T26K possibly damaging Het
Qsox1 T A 1: 155,786,925 probably null Het
Rad51ap2 T A 12: 11,456,464 V129D probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Rxfp2 T G 5: 150,070,270 V585G possibly damaging Het
Sftpd G A 14: 41,172,580 T294I probably benign Het
Sh3gl1 A G 17: 56,036,456 S2P probably damaging Het
Slc38a10 A T 11: 120,129,264 F321I probably damaging Het
Slc4a10 T A 2: 62,244,343 probably null Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Slit1 T C 19: 41,614,417 E985G probably benign Het
Smurf1 C T 5: 144,882,593 E575K probably damaging Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tmem182 T C 1: 40,838,370 I135T probably damaging Het
Tmem67 T C 4: 12,073,922 Y298C probably damaging Het
Trappc9 A G 15: 72,590,792 C1026R probably damaging Het
Troap A G 15: 99,078,832 D279G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r25 A T 6: 123,823,647 C579S probably damaging Het
Zbtb18 A G 1: 177,447,479 D126G probably damaging Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104342422 missense probably benign 0.00
R7963:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7971:Kansl1 UTSW 11 104342422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAAGCATGTCAGCTGGGG -3'
(R):5'- CCATGTGGTATAGATGTTAGCATTGC -3'

Sequencing Primer
(F):5'- CATGTCAGCTGGGGGTTATATTCTAC -3'
(R):5'- AGCATTGCTCTTGGATTTCACTCAG -3'
Posted On2015-06-20