Mutagenetix > Incidental Mutation

Incidental Mutation 'R4282:Kansl1'

322955

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

041650-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4282 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104378689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 476 (N476S)

Ref Sequence

ENSEMBL: ENSMUSP00000102590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]

AlphaFold

Q80TG1

Predicted Effect

probably benign
Transcript: ENSMUST00000018556
AA Change: N476S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: N476S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106971
AA Change: N476S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: N476S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106972
AA Change: N476S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: N476S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106977
AA Change: N476S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: N476S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080O16Rik	T	C	X: 51,968,990	Y273C	probably damaging	Het
1700092K14Rik	A	C	11: 114,199,144		noncoding transcript	Het
4930415L06Rik	A	T	X: 89,932,499	W31R	probably damaging	Het
Abca17	G	T	17: 24,299,060	D758E	possibly damaging	Het
Adam28	A	G	14: 68,647,706	V65A	possibly damaging	Het
Adgra2	T	A	8: 27,119,244	M616K	possibly damaging	Het
Aldh3b2	A	G	19: 3,977,636	D59G	probably benign	Het
Ankrd28	A	G	14: 31,745,225	V260A	possibly damaging	Het
Bbs7	A	G	3: 36,573,571	V689A	probably damaging	Het
Cacna1e	A	G	1: 154,426,550	F1653S	probably benign	Het
Cd55b	T	C	1: 130,416,859	D213G	probably damaging	Het
Colgalt2	G	A	1: 152,468,531	V115M	probably damaging	Het
Ddx60	T	C	8: 61,994,393	V1138A	probably damaging	Het
Defa27	A	G	8: 21,315,616	N24S	probably benign	Het
Defb40	A	G	8: 18,978,077	S14P	probably damaging	Het
Dnmt3a	G	A	12: 3,901,665	G681R	probably damaging	Het
Dus2	C	T	8: 106,048,654	A271V	probably benign	Het
Fabp3	C	T	4: 130,312,452		probably null	Het
Fancg	T	C	4: 43,003,830	D533G	probably damaging	Het
Frem3	T	C	8: 80,614,141	V1021A	probably benign	Het
Gmip	T	A	8: 69,813,601		probably benign	Het
Hspb6	T	C	7: 30,553,464	S44P	possibly damaging	Het
Jsrp1	T	C	10: 80,810,356	I50V	probably benign	Het
Kcnq2	T	C	2: 181,081,153	D810G	probably damaging	Het
Maml2	C	A	9: 13,620,110	L207I	possibly damaging	Het
Myo3a	A	T	2: 22,340,278	E508D	probably benign	Het
Nav1	T	A	1: 135,457,913		probably benign	Het
Ndrg3	A	T	2: 156,948,294	C90S	possibly damaging	Het
Orc1	A	G	4: 108,606,274	S663G	probably benign	Het
Pcdhb14	T	A	18: 37,450,142	L767H	probably damaging	Het
Pcgf1	T	A	6: 83,079,733	L90Q	probably damaging	Het
Pnma5	T	C	X: 73,035,430	M549V	probably benign	Het
Por	C	A	5: 135,715,961	T26K	possibly damaging	Het
Qsox1	T	A	1: 155,786,925		probably null	Het
Rad51ap2	T	A	12: 11,456,464	V129D	probably benign	Het
Rec8	A	G	14: 55,618,634	H11R	probably damaging	Het
Rxfp2	T	G	5: 150,070,270	V585G	possibly damaging	Het
Sftpd	G	A	14: 41,172,580	T294I	probably benign	Het
Sh3gl1	A	G	17: 56,036,456	S2P	probably damaging	Het
Slc38a10	A	T	11: 120,129,264	F321I	probably damaging	Het
Slc4a10	T	A	2: 62,244,343		probably null	Het
Slco6b1	A	G	1: 96,997,390		noncoding transcript	Het
Slit1	T	C	19: 41,614,417	E985G	probably benign	Het
Smurf1	C	T	5: 144,882,593	E575K	probably damaging	Het
Sned1	A	T	1: 93,285,855	R426*	probably null	Het
Tas2r123	G	A	6: 132,848,045	V302I	possibly damaging	Het
Tmem182	T	C	1: 40,838,370	I135T	probably damaging	Het
Tmem67	T	C	4: 12,073,922	Y298C	probably damaging	Het
Trappc9	A	G	15: 72,590,792	C1026R	probably damaging	Het
Troap	A	G	15: 99,078,832	D279G	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vmn1r23	T	C	6: 57,926,467	T109A	probably benign	Het
Vmn2r25	A	T	6: 123,823,647	C579S	probably damaging	Het
Zbtb18	A	G	1: 177,447,479	D126G	probably damaging	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign
R9033:Kansl1	UTSW	11	104357530	missense	probably benign	0.00
R9192:Kansl1	UTSW	11	104336316	missense	probably damaging	1.00
R9494:Kansl1	UTSW	11	104356740	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTAAGCATGTCAGCTGGGG -3'
(R):5'- CCATGTGGTATAGATGTTAGCATTGC -3'

Sequencing Primer
(F):5'- CATGTCAGCTGGGGGTTATATTCTAC -3'
(R):5'- AGCATTGCTCTTGGATTTCACTCAG -3'

Posted On

2015-06-20