Incidental Mutation 'R4282:Sftpd'
ID322961
Institutional Source Beutler Lab
Gene Symbol Sftpd
Ensembl Gene ENSMUSG00000021795
Gene Namesurfactant associated protein D
SynonymsSP-D, Sftp4
MMRRC Submission 041650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R4282 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location41172214-41185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41172580 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 294 (T294I)
Ref Sequence ENSEMBL: ENSMUSP00000076383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077136]
Predicted Effect probably benign
Transcript: ENSMUST00000077136
AA Change: T294I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076383
Gene: ENSMUSG00000021795
AA Change: T294I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Collagen 40 96 5.7e-11 PFAM
low complexity region 99 117 N/A INTRINSIC
low complexity region 123 150 N/A INTRINSIC
Pfam:Collagen 162 224 3.3e-12 PFAM
CLECT 252 373 7.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225892
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased pool sizes of alveolar and tissue phosphatidylcholine, accumulation of surfactant lipids, altered phospholipid structure, emphysema, and pulmonary fibrosis and chronic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
1700092K14Rik A C 11: 114,199,144 noncoding transcript Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Abca17 G T 17: 24,299,060 D758E possibly damaging Het
Adam28 A G 14: 68,647,706 V65A possibly damaging Het
Adgra2 T A 8: 27,119,244 M616K possibly damaging Het
Aldh3b2 A G 19: 3,977,636 D59G probably benign Het
Ankrd28 A G 14: 31,745,225 V260A possibly damaging Het
Bbs7 A G 3: 36,573,571 V689A probably damaging Het
Cacna1e A G 1: 154,426,550 F1653S probably benign Het
Cd55b T C 1: 130,416,859 D213G probably damaging Het
Colgalt2 G A 1: 152,468,531 V115M probably damaging Het
Ddx60 T C 8: 61,994,393 V1138A probably damaging Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Dus2 C T 8: 106,048,654 A271V probably benign Het
Fabp3 C T 4: 130,312,452 probably null Het
Fancg T C 4: 43,003,830 D533G probably damaging Het
Frem3 T C 8: 80,614,141 V1021A probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hspb6 T C 7: 30,553,464 S44P possibly damaging Het
Jsrp1 T C 10: 80,810,356 I50V probably benign Het
Kansl1 T C 11: 104,378,689 N476S probably benign Het
Kcnq2 T C 2: 181,081,153 D810G probably damaging Het
Maml2 C A 9: 13,620,110 L207I possibly damaging Het
Myo3a A T 2: 22,340,278 E508D probably benign Het
Nav1 T A 1: 135,457,913 probably benign Het
Ndrg3 A T 2: 156,948,294 C90S possibly damaging Het
Orc1 A G 4: 108,606,274 S663G probably benign Het
Pcdhb14 T A 18: 37,450,142 L767H probably damaging Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Por C A 5: 135,715,961 T26K possibly damaging Het
Qsox1 T A 1: 155,786,925 probably null Het
Rad51ap2 T A 12: 11,456,464 V129D probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Rxfp2 T G 5: 150,070,270 V585G possibly damaging Het
Sh3gl1 A G 17: 56,036,456 S2P probably damaging Het
Slc38a10 A T 11: 120,129,264 F321I probably damaging Het
Slc4a10 T A 2: 62,244,343 probably null Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Slit1 T C 19: 41,614,417 E985G probably benign Het
Smurf1 C T 5: 144,882,593 E575K probably damaging Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tmem182 T C 1: 40,838,370 I135T probably damaging Het
Tmem67 T C 4: 12,073,922 Y298C probably damaging Het
Trappc9 A G 15: 72,590,792 C1026R probably damaging Het
Troap A G 15: 99,078,832 D279G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r25 A T 6: 123,823,647 C579S probably damaging Het
Zbtb18 A G 1: 177,447,479 D126G probably damaging Het
Other mutations in Sftpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Sftpd APN 14 41172635 missense probably benign 0.32
IGL02252:Sftpd APN 14 41172514 missense probably damaging 1.00
IGL02283:Sftpd APN 14 41172466 missense probably benign 0.01
R1474:Sftpd UTSW 14 41172427 missense probably damaging 0.99
R2302:Sftpd UTSW 14 41172442 missense probably damaging 1.00
R6945:Sftpd UTSW 14 41174492 missense possibly damaging 0.88
R8069:Sftpd UTSW 14 41172581 missense probably benign
R8463:Sftpd UTSW 14 41175626 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCTCCACACAGTTCTCTGC -3'
(R):5'- GGTTGAGAGAAGGCTCCAAC -3'

Sequencing Primer
(F):5'- GCTCCACCATTGTTGTTGGGC -3'
(R):5'- ATTTCTCACAGGCATCTAAGGGC -3'
Posted On2015-06-20