Incidental Mutation 'R4282:Adam28'
ID 322963
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms D430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission 041650-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R4282 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 68606027-68655842 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68647706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 65 (V65A)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000022642
AA Change: V65A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: V65A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111072
AA Change: V65A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: V65A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224039
AA Change: V65A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224131
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
1700092K14Rik A C 11: 114,199,144 noncoding transcript Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Abca17 G T 17: 24,299,060 D758E possibly damaging Het
Adgra2 T A 8: 27,119,244 M616K possibly damaging Het
Aldh3b2 A G 19: 3,977,636 D59G probably benign Het
Ankrd28 A G 14: 31,745,225 V260A possibly damaging Het
Bbs7 A G 3: 36,573,571 V689A probably damaging Het
Cacna1e A G 1: 154,426,550 F1653S probably benign Het
Cd55b T C 1: 130,416,859 D213G probably damaging Het
Colgalt2 G A 1: 152,468,531 V115M probably damaging Het
Ddx60 T C 8: 61,994,393 V1138A probably damaging Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Dus2 C T 8: 106,048,654 A271V probably benign Het
Fabp3 C T 4: 130,312,452 probably null Het
Fancg T C 4: 43,003,830 D533G probably damaging Het
Frem3 T C 8: 80,614,141 V1021A probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hspb6 T C 7: 30,553,464 S44P possibly damaging Het
Jsrp1 T C 10: 80,810,356 I50V probably benign Het
Kansl1 T C 11: 104,378,689 N476S probably benign Het
Kcnq2 T C 2: 181,081,153 D810G probably damaging Het
Maml2 C A 9: 13,620,110 L207I possibly damaging Het
Myo3a A T 2: 22,340,278 E508D probably benign Het
Nav1 T A 1: 135,457,913 probably benign Het
Ndrg3 A T 2: 156,948,294 C90S possibly damaging Het
Orc1 A G 4: 108,606,274 S663G probably benign Het
Pcdhb14 T A 18: 37,450,142 L767H probably damaging Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Por C A 5: 135,715,961 T26K possibly damaging Het
Qsox1 T A 1: 155,786,925 probably null Het
Rad51ap2 T A 12: 11,456,464 V129D probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Rxfp2 T G 5: 150,070,270 V585G possibly damaging Het
Sftpd G A 14: 41,172,580 T294I probably benign Het
Sh3gl1 A G 17: 56,036,456 S2P probably damaging Het
Slc38a10 A T 11: 120,129,264 F321I probably damaging Het
Slc4a10 T A 2: 62,244,343 probably null Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Slit1 T C 19: 41,614,417 E985G probably benign Het
Smurf1 C T 5: 144,882,593 E575K probably damaging Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tmem182 T C 1: 40,838,370 I135T probably damaging Het
Tmem67 T C 4: 12,073,922 Y298C probably damaging Het
Trappc9 A G 15: 72,590,792 C1026R probably damaging Het
Troap A G 15: 99,078,832 D279G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r25 A T 6: 123,823,647 C579S probably damaging Het
Zbtb18 A G 1: 177,447,479 D126G probably damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
R8469:Adam28 UTSW 14 68606580 missense probably benign 0.16
R8520:Adam28 UTSW 14 68642083 missense probably damaging 0.98
R9026:Adam28 UTSW 14 68609144 missense probably benign 0.16
R9163:Adam28 UTSW 14 68629082 missense probably damaging 0.98
R9264:Adam28 UTSW 14 68607465 missense probably benign
R9304:Adam28 UTSW 14 68637497 missense probably damaging 1.00
R9357:Adam28 UTSW 14 68642030 missense probably benign 0.36
R9441:Adam28 UTSW 14 68637494 missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68626784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCTGTCCATCGGCACCTC -3'
(R):5'- CCTGTGGTCTAGACAGATAGTTGG -3'

Sequencing Primer
(F):5'- AAATTCACCGACTCCTTGGG -3'
(R):5'- GTCTAGACAGATAGTTGGTCTCACC -3'
Posted On 2015-06-20