Mutagenetix > Incidental Mutations

Incidental Mutation 'R4282:Trappc9'

322964

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

041650-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4282 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72590792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1026 (C1026R)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: C847R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: C847R

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: C1026R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: C1026R

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230426

Meta Mutation Damage Score

0.7063

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080O16Rik	T	C	X: 51,968,990	Y273C	probably damaging	Het
1700092K14Rik	A	C	11: 114,199,144		noncoding transcript	Het
4930415L06Rik	A	T	X: 89,932,499	W31R	probably damaging	Het
Abca17	G	T	17: 24,299,060	D758E	possibly damaging	Het
Adam28	A	G	14: 68,647,706	V65A	possibly damaging	Het
Adgra2	T	A	8: 27,119,244	M616K	possibly damaging	Het
Aldh3b2	A	G	19: 3,977,636	D59G	probably benign	Het
Ankrd28	A	G	14: 31,745,225	V260A	possibly damaging	Het
Bbs7	A	G	3: 36,573,571	V689A	probably damaging	Het
Cacna1e	A	G	1: 154,426,550	F1653S	probably benign	Het
Cd55b	T	C	1: 130,416,859	D213G	probably damaging	Het
Colgalt2	G	A	1: 152,468,531	V115M	probably damaging	Het
Ddx60	T	C	8: 61,994,393	V1138A	probably damaging	Het
Defa27	A	G	8: 21,315,616	N24S	probably benign	Het
Defb40	A	G	8: 18,978,077	S14P	probably damaging	Het
Dnmt3a	G	A	12: 3,901,665	G681R	probably damaging	Het
Dus2	C	T	8: 106,048,654	A271V	probably benign	Het
Fabp3	C	T	4: 130,312,452		probably null	Het
Fancg	T	C	4: 43,003,830	D533G	probably damaging	Het
Frem3	T	C	8: 80,614,141	V1021A	probably benign	Het
Gmip	T	A	8: 69,813,601		probably benign	Het
Hspb6	T	C	7: 30,553,464	S44P	possibly damaging	Het
Jsrp1	T	C	10: 80,810,356	I50V	probably benign	Het
Kansl1	T	C	11: 104,378,689	N476S	probably benign	Het
Kcnq2	T	C	2: 181,081,153	D810G	probably damaging	Het
Maml2	C	A	9: 13,620,110	L207I	possibly damaging	Het
Myo3a	A	T	2: 22,340,278	E508D	probably benign	Het
Nav1	T	A	1: 135,457,913		probably benign	Het
Ndrg3	A	T	2: 156,948,294	C90S	possibly damaging	Het
Orc1	A	G	4: 108,606,274	S663G	probably benign	Het
Pcdhb14	T	A	18: 37,450,142	L767H	probably damaging	Het
Pcgf1	T	A	6: 83,079,733	L90Q	probably damaging	Het
Pnma5	T	C	X: 73,035,430	M549V	probably benign	Het
Por	C	A	5: 135,715,961	T26K	possibly damaging	Het
Qsox1	T	A	1: 155,786,925		probably null	Het
Rad51ap2	T	A	12: 11,456,464	V129D	probably benign	Het
Rec8	A	G	14: 55,618,634	H11R	probably damaging	Het
Rxfp2	T	G	5: 150,070,270	V585G	possibly damaging	Het
Sftpd	G	A	14: 41,172,580	T294I	probably benign	Het
Sh3gl1	A	G	17: 56,036,456	S2P	probably damaging	Het
Slc38a10	A	T	11: 120,129,264	F321I	probably damaging	Het
Slc4a10	T	A	2: 62,244,343		probably null	Het
Slco6b1	A	G	1: 96,997,390		noncoding transcript	Het
Slit1	T	C	19: 41,614,417	E985G	probably benign	Het
Smurf1	C	T	5: 144,882,593	E575K	probably damaging	Het
Sned1	A	T	1: 93,285,855	R426*	probably null	Het
Tas2r123	G	A	6: 132,848,045	V302I	possibly damaging	Het
Tmem182	T	C	1: 40,838,370	I135T	probably damaging	Het
Tmem67	T	C	4: 12,073,922	Y298C	probably damaging	Het
Troap	A	G	15: 99,078,832	D279G	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vmn1r23	T	C	6: 57,926,467	T109A	probably benign	Het
Vmn2r25	A	T	6: 123,823,647	C579S	probably damaging	Het
Zbtb18	A	G	1: 177,447,479	D126G	probably damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- GTAGAAGGTACTGGAACCCAC -3'
(R):5'- AACAGATGTGGGCTCCTCTTG -3'

Sequencing Primer
(F):5'- CACAAAGGAGATGACATCATGC -3'
(R):5'- CTCTTGAACGGACAGCCTTTAGG -3'

Posted On

2015-06-20