Mutagenetix > Incidental Mutations

Incidental Mutation 'R4282:Trappc9'

322964

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

041650-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4282 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72590792 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1026 (C1026R)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: C847R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: C847R

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: C1026R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: C1026R

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230426

Meta Mutation Damage Score

0.7063

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080O16Rik	T	C	X: 51,968,990	Y273C	probably damaging	Het
1700092K14Rik	A	C	11: 114,199,144		noncoding transcript	Het
4930415L06Rik	A	T	X: 89,932,499	W31R	probably damaging	Het
Abca17	G	T	17: 24,299,060	D758E	possibly damaging	Het
Adam28	A	G	14: 68,647,706	V65A	possibly damaging	Het
Adgra2	T	A	8: 27,119,244	M616K	possibly damaging	Het
Aldh3b2	A	G	19: 3,977,636	D59G	probably benign	Het
Ankrd28	A	G	14: 31,745,225	V260A	possibly damaging	Het
Bbs7	A	G	3: 36,573,571	V689A	probably damaging	Het
Cacna1e	A	G	1: 154,426,550	F1653S	probably benign	Het
Cd55b	T	C	1: 130,416,859	D213G	probably damaging	Het
Colgalt2	G	A	1: 152,468,531	V115M	probably damaging	Het
Ddx60	T	C	8: 61,994,393	V1138A	probably damaging	Het
Defa27	A	G	8: 21,315,616	N24S	probably benign	Het
Defb40	A	G	8: 18,978,077	S14P	probably damaging	Het
Dnmt3a	G	A	12: 3,901,665	G681R	probably damaging	Het
Dus2	C	T	8: 106,048,654	A271V	probably benign	Het
Fabp3	C	T	4: 130,312,452		probably null	Het
Fancg	T	C	4: 43,003,830	D533G	probably damaging	Het
Frem3	T	C	8: 80,614,141	V1021A	probably benign	Het
Gmip	T	A	8: 69,813,601		probably benign	Het
Hspb6	T	C	7: 30,553,464	S44P	possibly damaging	Het
Jsrp1	T	C	10: 80,810,356	I50V	probably benign	Het
Kansl1	T	C	11: 104,378,689	N476S	probably benign	Het
Kcnq2	T	C	2: 181,081,153	D810G	probably damaging	Het
Maml2	C	A	9: 13,620,110	L207I	possibly damaging	Het
Myo3a	A	T	2: 22,340,278	E508D	probably benign	Het
Nav1	T	A	1: 135,457,913		probably benign	Het
Ndrg3	A	T	2: 156,948,294	C90S	possibly damaging	Het
Orc1	A	G	4: 108,606,274	S663G	probably benign	Het
Pcdhb14	T	A	18: 37,450,142	L767H	probably damaging	Het
Pcgf1	T	A	6: 83,079,733	L90Q	probably damaging	Het
Pnma5	T	C	X: 73,035,430	M549V	probably benign	Het
Por	C	A	5: 135,715,961	T26K	possibly damaging	Het
Qsox1	T	A	1: 155,786,925		probably null	Het
Rad51ap2	T	A	12: 11,456,464	V129D	probably benign	Het
Rec8	A	G	14: 55,618,634	H11R	probably damaging	Het
Rxfp2	T	G	5: 150,070,270	V585G	possibly damaging	Het
Sftpd	G	A	14: 41,172,580	T294I	probably benign	Het
Sh3gl1	A	G	17: 56,036,456	S2P	probably damaging	Het
Slc38a10	A	T	11: 120,129,264	F321I	probably damaging	Het
Slc4a10	T	A	2: 62,244,343		probably null	Het
Slco6b1	A	G	1: 96,997,390		noncoding transcript	Het
Slit1	T	C	19: 41,614,417	E985G	probably benign	Het
Smurf1	C	T	5: 144,882,593	E575K	probably damaging	Het
Sned1	A	T	1: 93,285,855	R426*	probably null	Het
Tas2r123	G	A	6: 132,848,045	V302I	possibly damaging	Het
Tmem182	T	C	1: 40,838,370	I135T	probably damaging	Het
Tmem67	T	C	4: 12,073,922	Y298C	probably damaging	Het
Troap	A	G	15: 99,078,832	D279G	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vmn1r23	T	C	6: 57,926,467	T109A	probably benign	Het
Vmn2r25	A	T	6: 123,823,647	C579S	probably damaging	Het
Zbtb18	A	G	1: 177,447,479	D126G	probably damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- GTAGAAGGTACTGGAACCCAC -3'
(R):5'- AACAGATGTGGGCTCCTCTTG -3'

Sequencing Primer
(F):5'- CACAAAGGAGATGACATCATGC -3'
(R):5'- CTCTTGAACGGACAGCCTTTAGG -3'

Posted On

2015-06-20