Incidental Mutation 'R4282:Trappc9'
ID 322964
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 041650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4282 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72590792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1026 (C1026R)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: C847R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: C847R

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: C1026R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: C1026R

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230426
Meta Mutation Damage Score 0.7063 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
1700092K14Rik A C 11: 114,199,144 noncoding transcript Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Abca17 G T 17: 24,299,060 D758E possibly damaging Het
Adam28 A G 14: 68,647,706 V65A possibly damaging Het
Adgra2 T A 8: 27,119,244 M616K possibly damaging Het
Aldh3b2 A G 19: 3,977,636 D59G probably benign Het
Ankrd28 A G 14: 31,745,225 V260A possibly damaging Het
Bbs7 A G 3: 36,573,571 V689A probably damaging Het
Cacna1e A G 1: 154,426,550 F1653S probably benign Het
Cd55b T C 1: 130,416,859 D213G probably damaging Het
Colgalt2 G A 1: 152,468,531 V115M probably damaging Het
Ddx60 T C 8: 61,994,393 V1138A probably damaging Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Dus2 C T 8: 106,048,654 A271V probably benign Het
Fabp3 C T 4: 130,312,452 probably null Het
Fancg T C 4: 43,003,830 D533G probably damaging Het
Frem3 T C 8: 80,614,141 V1021A probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hspb6 T C 7: 30,553,464 S44P possibly damaging Het
Jsrp1 T C 10: 80,810,356 I50V probably benign Het
Kansl1 T C 11: 104,378,689 N476S probably benign Het
Kcnq2 T C 2: 181,081,153 D810G probably damaging Het
Maml2 C A 9: 13,620,110 L207I possibly damaging Het
Myo3a A T 2: 22,340,278 E508D probably benign Het
Nav1 T A 1: 135,457,913 probably benign Het
Ndrg3 A T 2: 156,948,294 C90S possibly damaging Het
Orc1 A G 4: 108,606,274 S663G probably benign Het
Pcdhb14 T A 18: 37,450,142 L767H probably damaging Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Por C A 5: 135,715,961 T26K possibly damaging Het
Qsox1 T A 1: 155,786,925 probably null Het
Rad51ap2 T A 12: 11,456,464 V129D probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Rxfp2 T G 5: 150,070,270 V585G possibly damaging Het
Sftpd G A 14: 41,172,580 T294I probably benign Het
Sh3gl1 A G 17: 56,036,456 S2P probably damaging Het
Slc38a10 A T 11: 120,129,264 F321I probably damaging Het
Slc4a10 T A 2: 62,244,343 probably null Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Slit1 T C 19: 41,614,417 E985G probably benign Het
Smurf1 C T 5: 144,882,593 E575K probably damaging Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tmem182 T C 1: 40,838,370 I135T probably damaging Het
Tmem67 T C 4: 12,073,922 Y298C probably damaging Het
Troap A G 15: 99,078,832 D279G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r25 A T 6: 123,823,647 C579S probably damaging Het
Zbtb18 A G 1: 177,447,479 D126G probably damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
R9323:Trappc9 UTSW 15 72693582 missense probably benign 0.41
R9329:Trappc9 UTSW 15 72801353 missense unknown
R9366:Trappc9 UTSW 15 72937088 missense probably benign
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GTAGAAGGTACTGGAACCCAC -3'
(R):5'- AACAGATGTGGGCTCCTCTTG -3'

Sequencing Primer
(F):5'- CACAAAGGAGATGACATCATGC -3'
(R):5'- CTCTTGAACGGACAGCCTTTAGG -3'
Posted On 2015-06-20