Incidental Mutation 'R4282:Abca17'
ID322966
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 041650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4282 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24299060 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 758 (D758E)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039324
AA Change: D758E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: D758E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121226
AA Change: D758E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: D758E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
1700092K14Rik A C 11: 114,199,144 noncoding transcript Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Adam28 A G 14: 68,647,706 V65A possibly damaging Het
Adgra2 T A 8: 27,119,244 M616K possibly damaging Het
Aldh3b2 A G 19: 3,977,636 D59G probably benign Het
Ankrd28 A G 14: 31,745,225 V260A possibly damaging Het
Bbs7 A G 3: 36,573,571 V689A probably damaging Het
Cacna1e A G 1: 154,426,550 F1653S probably benign Het
Cd55b T C 1: 130,416,859 D213G probably damaging Het
Colgalt2 G A 1: 152,468,531 V115M probably damaging Het
Ddx60 T C 8: 61,994,393 V1138A probably damaging Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Dus2 C T 8: 106,048,654 A271V probably benign Het
Fabp3 C T 4: 130,312,452 probably null Het
Fancg T C 4: 43,003,830 D533G probably damaging Het
Frem3 T C 8: 80,614,141 V1021A probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hspb6 T C 7: 30,553,464 S44P possibly damaging Het
Jsrp1 T C 10: 80,810,356 I50V probably benign Het
Kansl1 T C 11: 104,378,689 N476S probably benign Het
Kcnq2 T C 2: 181,081,153 D810G probably damaging Het
Maml2 C A 9: 13,620,110 L207I possibly damaging Het
Myo3a A T 2: 22,340,278 E508D probably benign Het
Nav1 T A 1: 135,457,913 probably benign Het
Ndrg3 A T 2: 156,948,294 C90S possibly damaging Het
Orc1 A G 4: 108,606,274 S663G probably benign Het
Pcdhb14 T A 18: 37,450,142 L767H probably damaging Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Por C A 5: 135,715,961 T26K possibly damaging Het
Qsox1 T A 1: 155,786,925 probably null Het
Rad51ap2 T A 12: 11,456,464 V129D probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Rxfp2 T G 5: 150,070,270 V585G possibly damaging Het
Sftpd G A 14: 41,172,580 T294I probably benign Het
Sh3gl1 A G 17: 56,036,456 S2P probably damaging Het
Slc38a10 A T 11: 120,129,264 F321I probably damaging Het
Slc4a10 T A 2: 62,244,343 probably null Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Slit1 T C 19: 41,614,417 E985G probably benign Het
Smurf1 C T 5: 144,882,593 E575K probably damaging Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tmem182 T C 1: 40,838,370 I135T probably damaging Het
Tmem67 T C 4: 12,073,922 Y298C probably damaging Het
Trappc9 A G 15: 72,590,792 C1026R probably damaging Het
Troap A G 15: 99,078,832 D279G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r25 A T 6: 123,823,647 C579S probably damaging Het
Zbtb18 A G 1: 177,447,479 D126G probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGTGGGCATGTGTAAAGG -3'
(R):5'- TAAGCCACCCTGTTTGCCAC -3'

Sequencing Primer
(F):5'- CATGTGGGCATGTGTAAAGGATGTG -3'
(R):5'- GTCCATCTCCTGATTCTGAAACAAG -3'
Posted On2015-06-20