Incidental Mutation 'R4282:Abca17'
ID 322966
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A member 17
Synonyms
MMRRC Submission 041650-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4282 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24483233-24570042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 24518034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 758 (D758E)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect possibly damaging
Transcript: ENSMUST00000039324
AA Change: D758E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: D758E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121226
AA Change: D758E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: D758E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092K14Rik A C 11: 114,089,970 (GRCm39) noncoding transcript Het
Adam28 A G 14: 68,885,155 (GRCm39) V65A possibly damaging Het
Adgra2 T A 8: 27,609,272 (GRCm39) M616K possibly damaging Het
Aldh3b2 A G 19: 4,027,636 (GRCm39) D59G probably benign Het
Ankrd28 A G 14: 31,467,182 (GRCm39) V260A possibly damaging Het
Bbs7 A G 3: 36,627,720 (GRCm39) V689A probably damaging Het
Cacna1e A G 1: 154,302,296 (GRCm39) F1653S probably benign Het
Cd55b T C 1: 130,344,596 (GRCm39) D213G probably damaging Het
Colgalt2 G A 1: 152,344,282 (GRCm39) V115M probably damaging Het
Ddx60 T C 8: 62,447,427 (GRCm39) V1138A probably damaging Het
Defa27 A G 8: 21,805,632 (GRCm39) N24S probably benign Het
Defb40 A G 8: 19,028,093 (GRCm39) S14P probably damaging Het
Dnmt3a G A 12: 3,951,665 (GRCm39) G681R probably damaging Het
Dus2 C T 8: 106,775,286 (GRCm39) A271V probably benign Het
Fabp3 C T 4: 130,206,245 (GRCm39) probably null Het
Fancg T C 4: 43,003,830 (GRCm39) D533G probably damaging Het
Frem3 T C 8: 81,340,770 (GRCm39) V1021A probably benign Het
Gmip T A 8: 70,266,251 (GRCm39) probably benign Het
Hspb6 T C 7: 30,252,889 (GRCm39) S44P possibly damaging Het
Jsrp1 T C 10: 80,646,190 (GRCm39) I50V probably benign Het
Kansl1 T C 11: 104,269,515 (GRCm39) N476S probably benign Het
Kcnq2 T C 2: 180,722,946 (GRCm39) D810G probably damaging Het
Magea14 T C X: 51,057,867 (GRCm39) Y273C probably damaging Het
Maml2 C A 9: 13,531,406 (GRCm39) L207I possibly damaging Het
Myo3a A T 2: 22,345,089 (GRCm39) E508D probably benign Het
Nav1 T A 1: 135,385,651 (GRCm39) probably benign Het
Ndrg3 A T 2: 156,790,214 (GRCm39) C90S possibly damaging Het
Orc1 A G 4: 108,463,471 (GRCm39) S663G probably benign Het
Pcdhb14 T A 18: 37,583,195 (GRCm39) L767H probably damaging Het
Pcgf1 T A 6: 83,056,714 (GRCm39) L90Q probably damaging Het
Pnma5 T C X: 72,079,036 (GRCm39) M549V probably benign Het
Por C A 5: 135,744,815 (GRCm39) T26K possibly damaging Het
Ppp4r3c1 A T X: 88,976,105 (GRCm39) W31R probably damaging Het
Qsox1 T A 1: 155,662,671 (GRCm39) probably null Het
Rad51ap2 T A 12: 11,506,465 (GRCm39) V129D probably benign Het
Rec8 A G 14: 55,856,091 (GRCm39) H11R probably damaging Het
Rxfp2 T G 5: 149,993,735 (GRCm39) V585G possibly damaging Het
Sftpd G A 14: 40,894,537 (GRCm39) T294I probably benign Het
Sh3gl1 A G 17: 56,343,456 (GRCm39) S2P probably damaging Het
Slc38a10 A T 11: 120,020,090 (GRCm39) F321I probably damaging Het
Slc4a10 T A 2: 62,074,687 (GRCm39) probably null Het
Slco6b1 A G 1: 96,925,115 (GRCm39) noncoding transcript Het
Slit1 T C 19: 41,602,856 (GRCm39) E985G probably benign Het
Smurf1 C T 5: 144,819,403 (GRCm39) E575K probably damaging Het
Sned1 A T 1: 93,213,577 (GRCm39) R426* probably null Het
Tas2r123 G A 6: 132,825,008 (GRCm39) V302I possibly damaging Het
Tmem182 T C 1: 40,877,530 (GRCm39) I135T probably damaging Het
Tmem67 T C 4: 12,073,922 (GRCm39) Y298C probably damaging Het
Trappc9 A G 15: 72,462,641 (GRCm39) C1026R probably damaging Het
Troap A G 15: 98,976,713 (GRCm39) D279G probably benign Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Vmn1r23 T C 6: 57,903,452 (GRCm39) T109A probably benign Het
Vmn2r25 A T 6: 123,800,606 (GRCm39) C579S probably damaging Het
Zbtb18 A G 1: 177,275,045 (GRCm39) D126G probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,514,165 (GRCm39) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,519,294 (GRCm39) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,536,104 (GRCm39) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,565,202 (GRCm39) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,553,229 (GRCm39) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,506,909 (GRCm39) nonsense probably null
IGL02368:Abca17 APN 17 24,506,767 (GRCm39) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,498,036 (GRCm39) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,517,958 (GRCm39) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,546,679 (GRCm39) nonsense probably null
IGL02706:Abca17 APN 17 24,517,966 (GRCm39) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,499,455 (GRCm39) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,519,326 (GRCm39) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,500,340 (GRCm39) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,545,450 (GRCm39) splice site probably benign
IGL03299:Abca17 APN 17 24,484,565 (GRCm39) missense probably damaging 1.00
basin UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
Bowl UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,532,162 (GRCm39) splice site probably null
R0467:Abca17 UTSW 17 24,532,151 (GRCm39) splice site probably benign
R0671:Abca17 UTSW 17 24,500,223 (GRCm39) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,508,325 (GRCm39) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,504,733 (GRCm39) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,547,511 (GRCm39) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,554,594 (GRCm39) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,486,632 (GRCm39) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,486,531 (GRCm39) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,486,690 (GRCm39) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,526,549 (GRCm39) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,504,700 (GRCm39) missense probably benign 0.02
R2141:Abca17 UTSW 17 24,553,240 (GRCm39) missense probably benign 0.00
R2199:Abca17 UTSW 17 24,554,598 (GRCm39) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,500,190 (GRCm39) splice site probably null
R2442:Abca17 UTSW 17 24,547,606 (GRCm39) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,508,587 (GRCm39) splice site probably benign
R2848:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2859:Abca17 UTSW 17 24,500,288 (GRCm39) missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,508,511 (GRCm39) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,515,257 (GRCm39) missense probably benign 0.13
R4334:Abca17 UTSW 17 24,537,242 (GRCm39) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,498,020 (GRCm39) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,553,245 (GRCm39) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,540,058 (GRCm39) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,484,403 (GRCm39) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,526,427 (GRCm39) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,536,135 (GRCm39) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,508,388 (GRCm39) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,500,204 (GRCm39) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,526,541 (GRCm39) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,486,588 (GRCm39) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,546,642 (GRCm39) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,514,132 (GRCm39) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,506,820 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,537,165 (GRCm39) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,483,318 (GRCm39) missense unknown
R6404:Abca17 UTSW 17 24,484,892 (GRCm39) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,565,195 (GRCm39) nonsense probably null
R6819:Abca17 UTSW 17 24,506,767 (GRCm39) missense probably benign 0.01
R6828:Abca17 UTSW 17 24,545,389 (GRCm39) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,484,474 (GRCm39) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,546,725 (GRCm39) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,484,949 (GRCm39) missense probably damaging 1.00
R7157:Abca17 UTSW 17 24,554,564 (GRCm39) missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24,554,600 (GRCm39) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,539,983 (GRCm39) missense not run
R7352:Abca17 UTSW 17 24,508,028 (GRCm39) nonsense probably null
R7355:Abca17 UTSW 17 24,486,621 (GRCm39) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,510,529 (GRCm39) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,547,543 (GRCm39) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,484,507 (GRCm39) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,547,699 (GRCm39) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,536,196 (GRCm39) missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24,486,657 (GRCm39) missense probably damaging 1.00
R8517:Abca17 UTSW 17 24,536,207 (GRCm39) missense probably benign 0.00
R8811:Abca17 UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R8819:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,518,015 (GRCm39) missense probably benign
R9095:Abca17 UTSW 17 24,500,370 (GRCm39) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,565,207 (GRCm39) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,547,593 (GRCm39) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,483,479 (GRCm39) missense probably benign
R9351:Abca17 UTSW 17 24,510,751 (GRCm39) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,553,255 (GRCm39) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,483,273 (GRCm39) missense unknown
R9440:Abca17 UTSW 17 24,499,452 (GRCm39) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,484,480 (GRCm39) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,536,099 (GRCm39) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,517,934 (GRCm39) missense probably benign
R9770:Abca17 UTSW 17 24,514,121 (GRCm39) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,508,565 (GRCm39) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,506,706 (GRCm39) frame shift probably null
RF029:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,506,701 (GRCm39) frame shift probably null
RF036:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,536,137 (GRCm39) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,553,258 (GRCm39) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,498,081 (GRCm39) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,498,053 (GRCm39) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,565,193 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGTGGGCATGTGTAAAGG -3'
(R):5'- TAAGCCACCCTGTTTGCCAC -3'

Sequencing Primer
(F):5'- CATGTGGGCATGTGTAAAGGATGTG -3'
(R):5'- GTCCATCTCCTGATTCTGAAACAAG -3'
Posted On 2015-06-20