Mutagenetix > Incidental Mutation

Incidental Mutation 'R4290:Nup210l'

322990

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

041655-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R4290 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90207326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1736 (H1736L)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably benign
Transcript: ENSMUST00000029548
AA Change: H1736L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: H1736L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200410
AA Change: H1736L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: H1736L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Meta Mutation Damage Score

0.0859

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (73/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,594,012	N1545S	probably benign	Het
Arid1b	C	A	17: 5,040,663	S546R	probably damaging	Het
Arid3b	A	T	9: 57,790,430		probably benign	Het
Atf6b	T	A	17: 34,652,674	M428K	probably benign	Het
Atpaf1	A	T	4: 115,788,359	M142L	probably benign	Het
Auts2	A	G	5: 131,474,971	S225P	probably damaging	Het
Bclaf1	A	G	10: 20,323,778	Q20R	probably damaging	Het
Bivm	A	T	1: 44,138,633	R364S	probably damaging	Het
Brwd1	G	A	16: 96,017,604	P1343S	probably damaging	Het
Cckar	A	G	5: 53,706,497	S41P	probably benign	Het
Cfap221	A	G	1: 119,930,920	S728P	probably benign	Het
Chrna9	A	G	5: 65,977,138	K444R	probably benign	Het
Cox10	A	T	11: 63,964,255	V400E	probably benign	Het
Dact2	C	T	17: 14,196,571	E456K	probably benign	Het
Ddr2	A	G	1: 169,990,609	V443A	probably benign	Het
Dlg3	A	T	X: 100,796,682		probably benign	Het
En1	C	A	1: 120,603,757	A242E	unknown	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Gm6124	A	T	7: 39,222,771		noncoding transcript	Het
Gucy1a1	A	T	3: 82,094,759	F671Y	possibly damaging	Het
Hddc2	A	T	10: 31,314,587	M48L	possibly damaging	Het
Hepacam2	T	A	6: 3,487,237	Y40F	probably benign	Het
Ift80	A	G	3: 68,963,690	I191T	probably damaging	Het
Il19	T	A	1: 130,935,013	T58S	possibly damaging	Het
Itga2	G	A	13: 114,866,173	R594C	probably damaging	Het
Itga5	C	T	15: 103,352,257		probably null	Het
Kcna1	T	C	6: 126,641,875	D494G	probably damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Kmt2b	A	T	7: 30,581,836		probably null	Het
Kmt5b	T	C	19: 3,802,193	Y125H	possibly damaging	Het
Lbr	C	T	1: 181,820,702	C398Y	probably damaging	Het
Lmf1	T	C	17: 25,654,481	L320P	probably damaging	Het
Man1c1	T	A	4: 134,563,785	D600V	probably damaging	Het
Mapkapk3	T	C	9: 107,258,932		probably benign	Het
Mccc1	A	G	3: 35,990,068	V203A	probably damaging	Het
Mettl5	T	C	2: 69,880,832	N114S	probably benign	Het
Mindy2	T	A	9: 70,631,094	R320W	probably damaging	Het
Nrip1	A	G	16: 76,291,988	S894P	probably benign	Het
Olfr1396	T	A	11: 49,113,427	I100L	probably benign	Het
Olfr1508	T	C	14: 52,463,985	N8S	probably damaging	Het
Olfr169	A	T	16: 19,566,244	M213K	possibly damaging	Het
Olfr310	A	T	7: 86,269,760	F10I	probably damaging	Het
Olfr373	A	G	8: 72,099,768	T3A	probably benign	Het
Olfr711	A	C	7: 106,971,711	L211R	probably damaging	Het
Olfr926	A	G	9: 38,877,313	I46V	probably damaging	Het
Pcdhb5	T	A	18: 37,322,681	S705T	possibly damaging	Het
Phf14	C	T	6: 11,987,097	P559S	probably damaging	Het
Plpp4	A	G	7: 129,307,632	E22G	probably damaging	Het
Ppp4c	A	G	7: 126,792,059		probably null	Het
Rps15a-ps1	A	G	10: 106,192,635		noncoding transcript	Het
Rps27a	A	G	11: 29,545,933	Y140H	probably benign	Het
Sash1	A	G	10: 8,730,242	S795P	possibly damaging	Het
Slc22a21	T	C	11: 53,969,503	D34G	probably damaging	Het
Srsf6	T	C	2: 162,934,716		probably benign	Het
Stk32c	T	C	7: 139,120,788		probably null	Het
Tmem237	A	G	1: 59,119,836		probably benign	Het
Ttc19	A	G	11: 62,285,927		probably null	Het
Ttf2	T	C	3: 100,962,761	D332G	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vcan	A	G	13: 89,725,486	V83A	probably damaging	Het
Vmn1r192	T	A	13: 22,187,295	I252F	probably damaging	Het
Vmn2r101	A	T	17: 19,612,041	R766S	probably damaging	Het
Xndc1	T	A	7: 102,081,487	L288M	possibly damaging	Het
Zfa-ps	A	T	10: 52,543,711		noncoding transcript	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCATGCTCCGTGACTATCTCAG -3'
(R):5'- AGCTCACCTGCACCAGATG -3'

Sequencing Primer
(F):5'- CTGGAGCTCACTTTGTAGACCAG -3'
(R):5'- GATGACATCTGCTGGAAG -3'

Posted On

2015-06-20