Incidental Mutation 'R4290:Cox10'
ID 323024
Institutional Source Beutler Lab
Gene Symbol Cox10
Ensembl Gene ENSMUSG00000042148
Gene Name heme A:farnesyltransferase cytochrome c oxidase assembly factor 10
Synonyms 2410004F01Rik
MMRRC Submission 041655-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R4290 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 63853453-63970294 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63855081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 400 (V400E)
Ref Sequence ENSEMBL: ENSMUSP00000040138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049091]
AlphaFold Q8CFY5
Predicted Effect probably benign
Transcript: ENSMUST00000049091
AA Change: V400E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040138
Gene: ENSMUSG00000042148
AA Change: V400E

DomainStartEndE-ValueType
Pfam:UbiA 168 418 5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146915
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes heme A:farnesyltransferase, which is not a structural subunit but required for the expression of functional COX and functions in the maturation of the heme A prosthetic group of COX. This protein is predicted to contain 7-9 transmembrane domains localized in the mitochondrial inner membrane. A gene mutation, which results in the substitution of a lysine for an asparagine (N204K), is identified to be responsible for cytochrome c oxidase deficiency. In addition, this gene is disrupted in patients with CMT1A (Charcot-Marie-Tooth type 1A) duplication and with HNPP (hereditary neuropathy with liability to pressure palsies) deletion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,539,738 (GRCm39) N1545S probably benign Het
Arid1b C A 17: 5,090,938 (GRCm39) S546R probably damaging Het
Arid3b A T 9: 57,697,713 (GRCm39) probably benign Het
Atf6b T A 17: 34,871,648 (GRCm39) M428K probably benign Het
Atpaf1 A T 4: 115,645,556 (GRCm39) M142L probably benign Het
Auts2 A G 5: 131,503,809 (GRCm39) S225P probably damaging Het
Bclaf1 A G 10: 20,199,524 (GRCm39) Q20R probably damaging Het
Bivm A T 1: 44,177,793 (GRCm39) R364S probably damaging Het
Brwd1 G A 16: 95,818,804 (GRCm39) P1343S probably damaging Het
Cckar A G 5: 53,863,839 (GRCm39) S41P probably benign Het
Cfap221 A G 1: 119,858,650 (GRCm39) S728P probably benign Het
Chrna9 A G 5: 66,134,481 (GRCm39) K444R probably benign Het
Dact2 C T 17: 14,416,833 (GRCm39) E456K probably benign Het
Ddr2 A G 1: 169,818,178 (GRCm39) V443A probably benign Het
Dlg3 A T X: 99,840,288 (GRCm39) probably benign Het
En1 C A 1: 120,531,486 (GRCm39) A242E unknown Het
Fhdc1 C A 3: 84,352,133 (GRCm39) V1031F probably benign Het
Gm6124 A T 7: 38,872,195 (GRCm39) noncoding transcript Het
Gucy1a1 A T 3: 82,002,066 (GRCm39) F671Y possibly damaging Het
Hddc2 A T 10: 31,190,583 (GRCm39) M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 (GRCm39) Y40F probably benign Het
Ift80 A G 3: 68,871,023 (GRCm39) I191T probably damaging Het
Il19 T A 1: 130,862,750 (GRCm39) T58S possibly damaging Het
Itga2 G A 13: 115,002,709 (GRCm39) R594C probably damaging Het
Itga5 C T 15: 103,260,684 (GRCm39) probably null Het
Kcna1 T C 6: 126,618,838 (GRCm39) D494G probably damaging Het
Kcnv1 G A 15: 44,977,840 (GRCm39) T66M probably damaging Het
Kmt2b A T 7: 30,281,261 (GRCm39) probably null Het
Kmt5b T C 19: 3,852,193 (GRCm39) Y125H possibly damaging Het
Lbr C T 1: 181,648,267 (GRCm39) C398Y probably damaging Het
Lmf1 T C 17: 25,873,455 (GRCm39) L320P probably damaging Het
Man1c1 T A 4: 134,291,096 (GRCm39) D600V probably damaging Het
Mapkapk3 T C 9: 107,136,131 (GRCm39) probably benign Het
Mccc1 A G 3: 36,044,217 (GRCm39) V203A probably damaging Het
Mettl5 T C 2: 69,711,176 (GRCm39) N114S probably benign Het
Mindy2 T A 9: 70,538,376 (GRCm39) R320W probably damaging Het
Nrip1 A G 16: 76,088,876 (GRCm39) S894P probably benign Het
Nup210l A T 3: 90,114,633 (GRCm39) H1736L probably benign Het
Or14c46 A T 7: 85,918,968 (GRCm39) F10I probably damaging Het
Or2aj4 A T 16: 19,384,994 (GRCm39) M213K possibly damaging Het
Or2v2 T A 11: 49,004,254 (GRCm39) I100L probably benign Het
Or2z9 A G 8: 72,853,612 (GRCm39) T3A probably benign Het
Or4e1 T C 14: 52,701,442 (GRCm39) N8S probably damaging Het
Or6b6 A C 7: 106,570,918 (GRCm39) L211R probably damaging Het
Or8d2b A G 9: 38,788,609 (GRCm39) I46V probably damaging Het
Pcdhb5 T A 18: 37,455,734 (GRCm39) S705T possibly damaging Het
Phf14 C T 6: 11,987,096 (GRCm39) P559S probably damaging Het
Plpp4 A G 7: 128,909,356 (GRCm39) E22G probably damaging Het
Ppp4c A G 7: 126,391,231 (GRCm39) probably null Het
Rps15a-ps1 A G 10: 106,028,496 (GRCm39) noncoding transcript Het
Rps27a A G 11: 29,495,933 (GRCm39) Y140H probably benign Het
Sash1 A G 10: 8,606,006 (GRCm39) S795P possibly damaging Het
Slc22a21 T C 11: 53,860,329 (GRCm39) D34G probably damaging Het
Srsf6 T C 2: 162,776,636 (GRCm39) probably benign Het
Stk32c T C 7: 138,700,704 (GRCm39) probably null Het
Tmem237 A G 1: 59,158,995 (GRCm39) probably benign Het
Ttc19 A G 11: 62,176,753 (GRCm39) probably null Het
Ttf2 T C 3: 100,870,077 (GRCm39) D332G probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vcan A G 13: 89,873,605 (GRCm39) V83A probably damaging Het
Vmn1r192 T A 13: 22,371,465 (GRCm39) I252F probably damaging Het
Vmn2r101 A T 17: 19,832,303 (GRCm39) R766S probably damaging Het
Xndc1 T A 7: 101,730,694 (GRCm39) L288M possibly damaging Het
Zfa-ps A T 10: 52,419,807 (GRCm39) noncoding transcript Het
Other mutations in Cox10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02746:Cox10 APN 11 63,855,357 (GRCm39) splice site probably benign
PIT4504001:Cox10 UTSW 11 63,855,042 (GRCm39) missense possibly damaging 0.66
R0548:Cox10 UTSW 11 63,867,178 (GRCm39) missense probably damaging 1.00
R0811:Cox10 UTSW 11 63,962,539 (GRCm39) missense probably benign
R0812:Cox10 UTSW 11 63,962,539 (GRCm39) missense probably benign
R2175:Cox10 UTSW 11 63,962,475 (GRCm39) missense probably benign 0.01
R4681:Cox10 UTSW 11 63,867,277 (GRCm39) missense possibly damaging 0.94
R4770:Cox10 UTSW 11 63,854,989 (GRCm39) missense probably benign 0.00
R5873:Cox10 UTSW 11 63,962,512 (GRCm39) missense probably benign 0.00
R6457:Cox10 UTSW 11 63,855,198 (GRCm39) missense probably damaging 0.99
R7955:Cox10 UTSW 11 63,884,750 (GRCm39) missense probably benign 0.25
R8731:Cox10 UTSW 11 63,855,045 (GRCm39) missense probably damaging 1.00
R8821:Cox10 UTSW 11 63,855,306 (GRCm39) missense probably damaging 1.00
R8831:Cox10 UTSW 11 63,855,306 (GRCm39) missense probably damaging 1.00
R8883:Cox10 UTSW 11 63,884,775 (GRCm39) missense probably damaging 1.00
R9684:Cox10 UTSW 11 63,855,207 (GRCm39) missense probably damaging 1.00
X0064:Cox10 UTSW 11 63,884,783 (GRCm39) critical splice acceptor site probably null
Z1177:Cox10 UTSW 11 63,867,296 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAATACGCTTCCTGCTGGC -3'
(R):5'- ACTGTATGATGTCCGTCACC -3'

Sequencing Primer
(F):5'- CAGTGCTGTCCGTGTGTC -3'
(R):5'- GTATGATGTCCGTCACCCATCCAG -3'
Posted On 2015-06-20