Incidental Mutation 'R4290:Brwd1'
ID323033
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96017604 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1343 (P1343S)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000153398]
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: P1343S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: P1343S

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: P1343S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: P1343S

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: P1343S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: P1343S

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147655
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: P1343S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: P1343S

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Meta Mutation Damage Score 0.6191 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
bromide UTSW 16 96064887 missense probably damaging 1.00
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
Soporific UTSW 16 96033843 nonsense probably null
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 splice site probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
R8120:Brwd1 UTSW 16 96019449 missense probably benign 0.23
R8187:Brwd1 UTSW 16 96002734 missense probably damaging 0.98
R8359:Brwd1 UTSW 16 96016209 missense probably damaging 1.00
R8511:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CACACATGGTTCCTGTGCAAC -3'
(R):5'- ACCATAAAGTACATGTCCTCTCTCC -3'

Sequencing Primer
(F):5'- CTGTACTGCAACTAGCCTAGTGG -3'
(R):5'- CATTTCCTACCTAGGCTGAAGTAAC -3'
Posted On2015-06-20