Incidental Mutation 'R4291:Olfr1120'
ID323046
Institutional Source Beutler Lab
Gene Symbol Olfr1120
Ensembl Gene ENSMUSG00000081234
Gene Nameolfactory receptor 1120
SynonymsMOR264-2, GA_x6K02T2Q125-48849180-48850100
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87354815-87361786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87358075 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 210 (M210I)
Ref Sequence ENSEMBL: ENSMUSP00000149911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058737] [ENSMUST00000215163]
Predicted Effect probably benign
Transcript: ENSMUST00000058737
AA Change: M210I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051931
Gene: ENSMUSG00000081234
AA Change: M210I

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 1.1e-54 PFAM
Pfam:7tm_1 47 296 7.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215163
AA Change: M210I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215282
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Olfr1120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr1120 APN 2 87357545 missense possibly damaging 0.82
IGL01680:Olfr1120 APN 2 87357905 missense probably damaging 1.00
IGL02210:Olfr1120 APN 2 87358003 missense probably damaging 1.00
R0624:Olfr1120 UTSW 2 87357682 nonsense probably null
R0849:Olfr1120 UTSW 2 87358265 missense probably benign 0.00
R1298:Olfr1120 UTSW 2 87358070 missense probably benign 0.20
R2309:Olfr1120 UTSW 2 87357954 missense probably damaging 1.00
R4237:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R5679:Olfr1120 UTSW 2 87357545 missense possibly damaging 0.82
R5939:Olfr1120 UTSW 2 87357704 missense possibly damaging 0.55
R6269:Olfr1120 UTSW 2 87846874 missense possibly damaging 0.65
R6551:Olfr1120 UTSW 2 87846661 missense possibly damaging 0.89
R7024:Olfr1120 UTSW 2 87357722 missense probably benign 0.06
R7242:Olfr1120 UTSW 2 87358082 missense probably benign 0.13
R7359:Olfr1120 UTSW 2 87358211 missense possibly damaging 0.77
R7444:Olfr1120 UTSW 2 87358100 missense possibly damaging 0.94
R7488:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R7646:Olfr1120 UTSW 2 87357758 missense probably benign 0.00
R7711:Olfr1120 UTSW 2 87357527 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGTCATGAATCCAACAAAGTGC -3'
(R):5'- GAATGAATGGACTTTGGCCTCAAG -3'

Sequencing Primer
(F):5'- AAAGTGCACTCAGCTGGCTG -3'
(R):5'- GGCCTCAAGTAGTTAATGGTAGC -3'
Posted On2015-06-20