Incidental Mutation 'R4291:Enpep'
ID323051
Institutional Source Beutler Lab
Gene Symbol Enpep
Ensembl Gene ENSMUSG00000028024
Gene Nameglutamyl aminopeptidase
SynonymsLy51, aminopeptidase-A, Bp-1/6C3, 6030431M22Rik, APA, Ly-51
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129269175-129332720 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 129270317 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 934 (R934*)
Ref Sequence ENSEMBL: ENSMUSP00000029658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029658]
Predicted Effect probably null
Transcript: ENSMUST00000029658
AA Change: R934*
SMART Domains Protein: ENSMUSP00000029658
Gene: ENSMUSG00000028024
AA Change: R934*

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M1 84 474 6e-147 PFAM
Pfam:ERAP1_C 607 925 1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170918
SMART Domains Protein: ENSMUSP00000128872
Gene: ENSMUSG00000028024

DomainStartEndE-ValueType
Pfam:Peptidase_M1 12 402 9.6e-148 PFAM
Meta Mutation Damage Score 0.9648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and morphologically unaffected with normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Enpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Enpep APN 3 129332082 missense possibly damaging 0.69
IGL01895:Enpep APN 3 129270334 missense possibly damaging 0.89
IGL02193:Enpep APN 3 129281687 missense possibly damaging 0.46
IGL02215:Enpep APN 3 129270277 splice site probably benign
IGL02511:Enpep APN 3 129321410 missense probably damaging 1.00
IGL02579:Enpep APN 3 129284090 missense probably benign 0.07
IGL02634:Enpep APN 3 129309857 missense probably damaging 1.00
IGL03034:Enpep APN 3 129298950 missense probably damaging 0.99
IGL03214:Enpep APN 3 129293247 missense probably benign
IGL03401:Enpep APN 3 129312620 missense probably benign 0.01
P0041:Enpep UTSW 3 129332198 missense possibly damaging 0.80
R0371:Enpep UTSW 3 129283867 critical splice donor site probably null
R0479:Enpep UTSW 3 129312674 missense possibly damaging 0.65
R1036:Enpep UTSW 3 129284109 missense probably damaging 0.99
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1584:Enpep UTSW 3 129319448 missense probably damaging 1.00
R2060:Enpep UTSW 3 129280523 missense probably benign 0.14
R2101:Enpep UTSW 3 129298938 missense probably benign 0.00
R2153:Enpep UTSW 3 129280582 missense probably damaging 0.99
R2474:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3618:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3619:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R4275:Enpep UTSW 3 129332278 missense probably benign 0.02
R4438:Enpep UTSW 3 129284091 missense possibly damaging 0.94
R4570:Enpep UTSW 3 129281548 missense possibly damaging 0.67
R4678:Enpep UTSW 3 129303713 critical splice donor site probably null
R4679:Enpep UTSW 3 129303713 critical splice donor site probably null
R4748:Enpep UTSW 3 129332163 missense probably damaging 1.00
R4878:Enpep UTSW 3 129276771 missense probably benign 0.17
R4954:Enpep UTSW 3 129284180 missense probably damaging 0.98
R5074:Enpep UTSW 3 129303755 missense probably damaging 1.00
R5261:Enpep UTSW 3 129305426 missense probably damaging 1.00
R5328:Enpep UTSW 3 129280510 missense probably benign 0.30
R5661:Enpep UTSW 3 129276757 missense probably damaging 0.98
R5687:Enpep UTSW 3 129299094 splice site probably null
R5695:Enpep UTSW 3 129309099 missense probably damaging 1.00
R5697:Enpep UTSW 3 129309123 missense probably benign
R5889:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5940:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5968:Enpep UTSW 3 129280938 missense probably benign
R5976:Enpep UTSW 3 129299124 missense probably damaging 0.97
R6151:Enpep UTSW 3 129332418 missense possibly damaging 0.82
R6367:Enpep UTSW 3 129332081 missense possibly damaging 0.94
R6468:Enpep UTSW 3 129331860 critical splice donor site probably null
R6484:Enpep UTSW 3 129321481 missense probably damaging 0.96
R6938:Enpep UTSW 3 129298950 missense probably damaging 0.99
R6989:Enpep UTSW 3 129280950 missense probably damaging 1.00
R7073:Enpep UTSW 3 129312670 nonsense probably null
R7258:Enpep UTSW 3 129332075 missense probably benign 0.01
R7452:Enpep UTSW 3 129271403 missense possibly damaging 0.81
R7576:Enpep UTSW 3 129284091 missense probably benign 0.03
R7684:Enpep UTSW 3 129321445 missense probably damaging 1.00
R7697:Enpep UTSW 3 129309101 missense probably damaging 1.00
R8050:Enpep UTSW 3 129305516 missense probably damaging 1.00
R8080:Enpep UTSW 3 129299134 missense probably damaging 1.00
R8318:Enpep UTSW 3 129270337 missense probably damaging 1.00
Z1177:Enpep UTSW 3 129276680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTACTTAGCAAAAGCAGAACTGG -3'
(R):5'- TTGTTCTGAGTGCTGCACCAG -3'

Sequencing Primer
(F):5'- GCAGAACTGGTTTCAAAGGCTCC -3'
(R):5'- TGCACCAGGAGATGCCATC -3'
Posted On2015-06-20